Incidental Mutation 'R6219:Olfr1356'
ID503906
Institutional Source Beutler Lab
Gene Symbol Olfr1356
Ensembl Gene ENSMUSG00000051190
Gene Nameolfactory receptor 1356
SynonymsMOR142-1, MOR142-2_p, GA_x6K02T2QGN0-2962025-2962987
MMRRC Submission 044351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6219 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78845052-78852166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78847259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 219 (S219P)
Ref Sequence ENSEMBL: ENSMUSP00000144815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061289] [ENSMUST00000205100]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061289
AA Change: S219P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054345
Gene: ENSMUSG00000051190
AA Change: S219P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205100
AA Change: S219P

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144815
Gene: ENSMUSG00000051190
AA Change: S219P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Meta Mutation Damage Score 0.2635 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik T C 4: 136,462,748 S147P unknown Het
Acat2 T C 17: 12,960,717 probably benign Het
Ano2 A G 6: 125,815,590 D349G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ccnf C A 17: 24,226,704 E523* probably null Het
Ccr10 C T 11: 101,174,549 A52T possibly damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cmya5 T C 13: 93,094,443 E1379G probably damaging Het
Cyfip1 A G 7: 55,908,441 D822G possibly damaging Het
Cyp4a29 A C 4: 115,249,730 T195P probably damaging Het
Dmxl1 A T 18: 49,902,367 T2283S probably damaging Het
Dnah7b A G 1: 46,233,585 D2291G probably benign Het
Dock3 T A 9: 106,994,881 L493F probably damaging Het
Fbxw7 G A 3: 84,969,213 G227D probably damaging Het
Fmo2 A T 1: 162,880,516 V350D probably damaging Het
Glis1 C T 4: 107,631,905 P487S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,641 V485E probably damaging Het
Gm29776 G T 14: 54,695,659 Q356K noncoding transcript Het
Gm35315 G T 5: 110,078,544 T343K probably benign Het
Gpr141 A G 13: 19,752,527 I26T probably benign Het
Hectd4 T G 5: 121,308,878 V311G possibly damaging Het
Ino80d C T 1: 63,079,047 E322K possibly damaging Het
Irs2 A G 8: 11,005,121 S1104P probably damaging Het
Lama1 T C 17: 67,790,856 F1744L probably benign Het
Lcn10 A T 2: 25,683,575 R55* probably null Het
Lrp2 A T 2: 69,469,478 C3077S probably damaging Het
Mdc1 T A 17: 35,850,674 S826R probably benign Het
Nr2c1 G T 10: 94,163,786 V103L probably benign Het
Nup133 A T 8: 123,936,873 D310E possibly damaging Het
Pip5k1b T A 19: 24,381,823 E112D probably damaging Het
Reln T C 5: 21,948,596 K2237E probably damaging Het
Sirt2 A G 7: 28,767,515 probably benign Het
Slit2 A T 5: 48,302,428 H1350L possibly damaging Het
Snx15 A G 19: 6,121,508 S179P probably damaging Het
Sp8 T G 12: 118,848,667 S86A probably benign Het
Sptbn5 T C 2: 120,077,322 probably benign Het
Tfap4 A G 16: 4,547,311 S196P probably damaging Het
Tgm3 T C 2: 130,038,610 probably null Het
Tnks2 T C 19: 36,866,204 probably benign Het
Ttll11 A T 2: 35,752,499 probably null Het
Vwa3b C A 1: 37,100,698 Q367K possibly damaging Het
Zdhhc20 A T 14: 57,840,883 V312E probably damaging Het
Other mutations in Olfr1356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Olfr1356 APN 10 78847763 missense probably damaging 1.00
IGL01343:Olfr1356 APN 10 78847597 missense probably damaging 0.97
IGL01576:Olfr1356 APN 10 78847373 missense possibly damaging 0.94
IGL02314:Olfr1356 APN 10 78847265 missense probably damaging 1.00
IGL02474:Olfr1356 APN 10 78847063 missense probably damaging 1.00
IGL02960:Olfr1356 APN 10 78847537 missense probably damaging 1.00
IGL03049:Olfr1356 APN 10 78847522 missense possibly damaging 0.81
IGL03328:Olfr1356 APN 10 78847367 missense probably benign 0.39
R1602:Olfr1356 UTSW 10 78846968 missense probably benign
R1722:Olfr1356 UTSW 10 78846971 missense probably benign
R2178:Olfr1356 UTSW 10 78847778 missense probably damaging 0.96
R3903:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R3904:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R4241:Olfr1356 UTSW 10 78847905 missense probably benign 0.00
R4833:Olfr1356 UTSW 10 78847575 missense probably damaging 1.00
R5465:Olfr1356 UTSW 10 78847018 missense probably benign 0.00
R5527:Olfr1356 UTSW 10 78847775 missense probably benign 0.02
R5606:Olfr1356 UTSW 10 78847561 missense probably benign 0.19
R5977:Olfr1356 UTSW 10 78847738 missense possibly damaging 0.95
R6996:Olfr1356 UTSW 10 78847517 missense probably benign 0.00
R7136:Olfr1356 UTSW 10 78847781 missense probably benign 0.43
R7782:Olfr1356 UTSW 10 78847613 missense probably benign 0.01
R7996:Olfr1356 UTSW 10 78847321 missense probably damaging 1.00
Z1176:Olfr1356 UTSW 10 78847021 missense possibly damaging 0.73
Z1177:Olfr1356 UTSW 10 78847456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGGGAGTGACTATGCTGTAC -3'
(R):5'- AGCGTCATGAGTTCCCTACC -3'

Sequencing Primer
(F):5'- CTATGCTGTACATCAGTGAGGCAAC -3'
(R):5'- CCTGAGACCTTGACTGTGTTAAGAC -3'
Posted On2018-02-27