Incidental Mutation 'R6219:Ccnf'
ID503916
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Namecyclin F
SynonymsFbxo1, CycF
MMRRC Submission 044351-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6219 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24223232-24251409 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 24226704 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 523 (E523*)
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
Predicted Effect probably null
Transcript: ENSMUST00000115390
AA Change: E523*
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: E523*

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137883
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik T C 4: 136,462,748 S147P unknown Het
Acat2 T C 17: 12,960,717 probably benign Het
Ano2 A G 6: 125,815,590 D349G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ccr10 C T 11: 101,174,549 A52T possibly damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cmya5 T C 13: 93,094,443 E1379G probably damaging Het
Cyfip1 A G 7: 55,908,441 D822G possibly damaging Het
Cyp4a29 A C 4: 115,249,730 T195P probably damaging Het
Dmxl1 A T 18: 49,902,367 T2283S probably damaging Het
Dnah7b A G 1: 46,233,585 D2291G probably benign Het
Dock3 T A 9: 106,994,881 L493F probably damaging Het
Fbxw7 G A 3: 84,969,213 G227D probably damaging Het
Fmo2 A T 1: 162,880,516 V350D probably damaging Het
Glis1 C T 4: 107,631,905 P487S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,641 V485E probably damaging Het
Gm29776 G T 14: 54,695,659 Q356K noncoding transcript Het
Gm35315 G T 5: 110,078,544 T343K probably benign Het
Gpr141 A G 13: 19,752,527 I26T probably benign Het
Hectd4 T G 5: 121,308,878 V311G possibly damaging Het
Ino80d C T 1: 63,079,047 E322K possibly damaging Het
Irs2 A G 8: 11,005,121 S1104P probably damaging Het
Lama1 T C 17: 67,790,856 F1744L probably benign Het
Lcn10 A T 2: 25,683,575 R55* probably null Het
Lrp2 A T 2: 69,469,478 C3077S probably damaging Het
Mdc1 T A 17: 35,850,674 S826R probably benign Het
Nr2c1 G T 10: 94,163,786 V103L probably benign Het
Nup133 A T 8: 123,936,873 D310E possibly damaging Het
Olfr1356 A G 10: 78,847,259 S219P possibly damaging Het
Pip5k1b T A 19: 24,381,823 E112D probably damaging Het
Reln T C 5: 21,948,596 K2237E probably damaging Het
Sirt2 A G 7: 28,767,515 probably benign Het
Slit2 A T 5: 48,302,428 H1350L possibly damaging Het
Snx15 A G 19: 6,121,508 S179P probably damaging Het
Sp8 T G 12: 118,848,667 S86A probably benign Het
Sptbn5 T C 2: 120,077,322 probably benign Het
Tfap4 A G 16: 4,547,311 S196P probably damaging Het
Tgm3 T C 2: 130,038,610 probably null Het
Tnks2 T C 19: 36,866,204 probably benign Het
Ttll11 A T 2: 35,752,499 probably null Het
Vwa3b C A 1: 37,100,698 Q367K possibly damaging Het
Zdhhc20 A T 14: 57,840,883 V312E probably damaging Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24225012 missense probably damaging 1.00
IGL01942:Ccnf APN 17 24242320 missense probably benign 0.03
IGL02251:Ccnf APN 17 24226539 missense probably benign 0.00
IGL02945:Ccnf APN 17 24224916 missense probably damaging 0.99
IGL02952:Ccnf APN 17 24231325 missense possibly damaging 0.93
albuquerque UTSW 17 24223997 nonsense probably null
R0326:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24226777 missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24223997 nonsense probably null
R1072:Ccnf UTSW 17 24237162 missense probably damaging 0.97
R1693:Ccnf UTSW 17 24226540 frame shift probably null
R2147:Ccnf UTSW 17 24230314 critical splice donor site probably null
R3929:Ccnf UTSW 17 24234382 missense probably damaging 1.00
R4081:Ccnf UTSW 17 24223898 makesense probably null
R4260:Ccnf UTSW 17 24226767 missense probably damaging 1.00
R4579:Ccnf UTSW 17 24231329 nonsense probably null
R4651:Ccnf UTSW 17 24231786 missense probably damaging 1.00
R4844:Ccnf UTSW 17 24230357 nonsense probably null
R4876:Ccnf UTSW 17 24230337 missense probably damaging 1.00
R5234:Ccnf UTSW 17 24234437 nonsense probably null
R5352:Ccnf UTSW 17 24243273 splice site probably null
R5845:Ccnf UTSW 17 24240793 missense possibly damaging 0.95
R6084:Ccnf UTSW 17 24231837 missense probably damaging 1.00
R7021:Ccnf UTSW 17 24242231 missense probably damaging 1.00
R7176:Ccnf UTSW 17 24249402 missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24223915 missense probably benign 0.00
R7485:Ccnf UTSW 17 24249258 missense probably damaging 0.97
R7763:Ccnf UTSW 17 24225012 missense probably damaging 1.00
R8016:Ccnf UTSW 17 24231810 missense possibly damaging 0.84
R8034:Ccnf UTSW 17 24231831 missense probably damaging 1.00
R8069:Ccnf UTSW 17 24225015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGAAGGTGTGGATCTCC -3'
(R):5'- CTCTGACTGCTCCTATGTGAG -3'

Sequencing Primer
(F):5'- TGTGGATCTCCCCTGAGCTAG -3'
(R):5'- CTGACTGCTCCTATGTGAGATGAAC -3'
Posted On2018-02-27