Incidental Mutation 'R6219:Mdc1'
ID503917
Institutional Source Beutler Lab
Gene Symbol Mdc1
Ensembl Gene ENSMUSG00000061607
Gene Namemediator of DNA damage checkpoint 1
SynonymsNFBD1
MMRRC Submission 044351-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R6219 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35841515-35859670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35850674 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 826 (S826R)
Ref Sequence ENSEMBL: ENSMUSP00000080949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082337] [ENSMUST00000174124]
Predicted Effect probably benign
Transcript: ENSMUST00000082337
AA Change: S826R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607
AA Change: S826R

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225192
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: The protein encoded by this gene contains an N-terminal forkhead domain, two BRCA1 C-terminal (BRCT) motifs and a central domain with 7 divergent copies of an approximately 41-amino acid sequence. The encoded protein is required to activate the intra-S phase and G2/M phase cell cycle checkpoints in response to DNA damage. This nuclear protein interacts with phosphorylated histone H2AX near sites of DNA double-strand breaks through its BRCT motifs, and facilitates recruitment of the ATM kinase and meiotic recombination 11 protein complex to DNA damage foci. Mice with mutations in this gene exhibit growth retardation, male infertility, immune defects, chromosome instability, DNA repair defects, and radiation sensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are smaller and display increased susceptibility to ionizing radiation, male infertility, T and B cell abnormalities, and increased genomic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik T C 4: 136,462,748 S147P unknown Het
Acat2 T C 17: 12,960,717 probably benign Het
Ano2 A G 6: 125,815,590 D349G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ccnf C A 17: 24,226,704 E523* probably null Het
Ccr10 C T 11: 101,174,549 A52T possibly damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cmya5 T C 13: 93,094,443 E1379G probably damaging Het
Cyfip1 A G 7: 55,908,441 D822G possibly damaging Het
Cyp4a29 A C 4: 115,249,730 T195P probably damaging Het
Dmxl1 A T 18: 49,902,367 T2283S probably damaging Het
Dnah7b A G 1: 46,233,585 D2291G probably benign Het
Dock3 T A 9: 106,994,881 L493F probably damaging Het
Fbxw7 G A 3: 84,969,213 G227D probably damaging Het
Fmo2 A T 1: 162,880,516 V350D probably damaging Het
Glis1 C T 4: 107,631,905 P487S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,641 V485E probably damaging Het
Gm29776 G T 14: 54,695,659 Q356K noncoding transcript Het
Gm35315 G T 5: 110,078,544 T343K probably benign Het
Gpr141 A G 13: 19,752,527 I26T probably benign Het
Hectd4 T G 5: 121,308,878 V311G possibly damaging Het
Ino80d C T 1: 63,079,047 E322K possibly damaging Het
Irs2 A G 8: 11,005,121 S1104P probably damaging Het
Lama1 T C 17: 67,790,856 F1744L probably benign Het
Lcn10 A T 2: 25,683,575 R55* probably null Het
Lrp2 A T 2: 69,469,478 C3077S probably damaging Het
Nr2c1 G T 10: 94,163,786 V103L probably benign Het
Nup133 A T 8: 123,936,873 D310E possibly damaging Het
Olfr1356 A G 10: 78,847,259 S219P possibly damaging Het
Pip5k1b T A 19: 24,381,823 E112D probably damaging Het
Reln T C 5: 21,948,596 K2237E probably damaging Het
Sirt2 A G 7: 28,767,515 probably benign Het
Slit2 A T 5: 48,302,428 H1350L possibly damaging Het
Snx15 A G 19: 6,121,508 S179P probably damaging Het
Sp8 T G 12: 118,848,667 S86A probably benign Het
Sptbn5 T C 2: 120,077,322 probably benign Het
Tfap4 A G 16: 4,547,311 S196P probably damaging Het
Tgm3 T C 2: 130,038,610 probably null Het
Tnks2 T C 19: 36,866,204 probably benign Het
Ttll11 A T 2: 35,752,499 probably null Het
Vwa3b C A 1: 37,100,698 Q367K possibly damaging Het
Zdhhc20 A T 14: 57,840,883 V312E probably damaging Het
Other mutations in Mdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Mdc1 APN 17 35848020 missense probably benign 0.04
IGL01662:Mdc1 APN 17 35852505 missense probably benign 0.00
IGL01931:Mdc1 APN 17 35848231 missense probably benign 0.00
IGL02542:Mdc1 APN 17 35853156 missense probably damaging 0.96
IGL02823:Mdc1 APN 17 35852923 missense probably damaging 0.99
IGL03411:Mdc1 APN 17 35853126 missense probably benign 0.06
IGL02799:Mdc1 UTSW 17 35846191 missense possibly damaging 0.86
PIT4362001:Mdc1 UTSW 17 35844469 missense possibly damaging 0.72
R0054:Mdc1 UTSW 17 35849033 missense probably benign 0.00
R0129:Mdc1 UTSW 17 35854445 missense probably benign 0.04
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0131:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R0132:Mdc1 UTSW 17 35852581 missense probably damaging 0.99
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1406:Mdc1 UTSW 17 35853532 missense probably benign 0.10
R1597:Mdc1 UTSW 17 35845866 missense probably damaging 1.00
R1721:Mdc1 UTSW 17 35847826 missense possibly damaging 0.85
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1888:Mdc1 UTSW 17 35854225 missense probably benign 0.03
R1912:Mdc1 UTSW 17 35844538 missense probably benign 0.00
R1912:Mdc1 UTSW 17 35850811 missense probably benign 0.19
R1977:Mdc1 UTSW 17 35850930 missense probably benign 0.01
R2121:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2122:Mdc1 UTSW 17 35847943 missense probably benign 0.03
R2357:Mdc1 UTSW 17 35847445 missense probably benign 0.00
R2842:Mdc1 UTSW 17 35848794 missense probably benign 0.01
R2851:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2852:Mdc1 UTSW 17 35849010 missense probably benign 0.04
R2964:Mdc1 UTSW 17 35853637 missense possibly damaging 0.72
R2996:Mdc1 UTSW 17 35847893 unclassified probably benign
R3752:Mdc1 UTSW 17 35845929 missense probably damaging 1.00
R4234:Mdc1 UTSW 17 35848824 missense probably benign 0.00
R4641:Mdc1 UTSW 17 35857469 missense probably benign 0.09
R4706:Mdc1 UTSW 17 35852779 missense probably damaging 0.99
R4809:Mdc1 UTSW 17 35849101 critical splice donor site probably null
R4833:Mdc1 UTSW 17 35850394 missense probably benign 0.20
R5032:Mdc1 UTSW 17 35850589 missense probably benign 0.00
R5047:Mdc1 UTSW 17 35847844 missense probably benign 0.00
R5086:Mdc1 UTSW 17 35848630 missense probably benign 0.00
R5172:Mdc1 UTSW 17 35853090 missense probably benign 0.00
R5254:Mdc1 UTSW 17 35847922 missense probably benign 0.00
R5473:Mdc1 UTSW 17 35848060 missense probably benign 0.01
R5550:Mdc1 UTSW 17 35845884 missense possibly damaging 0.64
R5561:Mdc1 UTSW 17 35848546 missense probably benign 0.00
R5888:Mdc1 UTSW 17 35847820 missense probably benign 0.01
R6020:Mdc1 UTSW 17 35848633 missense probably benign 0.04
R6020:Mdc1 UTSW 17 35857572 missense probably benign 0.01
R7053:Mdc1 UTSW 17 35846326 missense probably benign 0.00
R7073:Mdc1 UTSW 17 35854068 missense probably benign 0.18
R7077:Mdc1 UTSW 17 35845947 missense probably damaging 0.97
R7424:Mdc1 UTSW 17 35853309 missense probably benign 0.04
R7443:Mdc1 UTSW 17 35850820 missense probably damaging 0.98
R7467:Mdc1 UTSW 17 35844556 missense probably benign 0.29
R7549:Mdc1 UTSW 17 35848857 missense probably null 0.04
R7655:Mdc1 UTSW 17 35850881 missense probably benign 0.01
R7656:Mdc1 UTSW 17 35850881 missense probably benign 0.01
RF025:Mdc1 UTSW 17 35854407 critical splice acceptor site probably benign
X0022:Mdc1 UTSW 17 35850937 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGAGAAAGCCATGGGTATACC -3'
(R):5'- AGTCCCTCAAGGTCCTTCAC -3'

Sequencing Primer
(F):5'- GTATACCAAAGGAAATGGCAGAC -3'
(R):5'- ACTCCAGGCTTTAGTGTTAGACTAGC -3'
Posted On2018-02-27