Incidental Mutation 'R6219:Pip5k1b'
ID503923
Institutional Source Beutler Lab
Gene Symbol Pip5k1b
Ensembl Gene ENSMUSG00000024867
Gene Namephosphatidylinositol-4-phosphate 5-kinase, type 1 beta
SynonymsPipk5b
MMRRC Submission 044351-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6219 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location24294794-24555872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24381823 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 112 (E112D)
Ref Sequence ENSEMBL: ENSMUSP00000108292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025800] [ENSMUST00000112673]
Predicted Effect probably damaging
Transcript: ENSMUST00000025800
AA Change: E112D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025800
Gene: ENSMUSG00000024867
AA Change: E112D

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 472 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112673
AA Change: E112D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108292
Gene: ENSMUSG00000024867
AA Change: E112D

DomainStartEndE-ValueType
PIPKc 53 396 1.1e-159 SMART
low complexity region 420 432 N/A INTRINSIC
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced passive cutaneous and systemic anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030445D17Rik T C 4: 136,462,748 S147P unknown Het
Acat2 T C 17: 12,960,717 probably benign Het
Ano2 A G 6: 125,815,590 D349G probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Ccnf C A 17: 24,226,704 E523* probably null Het
Ccr10 C T 11: 101,174,549 A52T possibly damaging Het
Cdc14b C T 13: 64,205,524 probably benign Het
Cmya5 T C 13: 93,094,443 E1379G probably damaging Het
Cyfip1 A G 7: 55,908,441 D822G possibly damaging Het
Cyp4a29 A C 4: 115,249,730 T195P probably damaging Het
Dmxl1 A T 18: 49,902,367 T2283S probably damaging Het
Dnah7b A G 1: 46,233,585 D2291G probably benign Het
Dock3 T A 9: 106,994,881 L493F probably damaging Het
Fbxw7 G A 3: 84,969,213 G227D probably damaging Het
Fmo2 A T 1: 162,880,516 V350D probably damaging Het
Glis1 C T 4: 107,631,905 P487S probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,641 V485E probably damaging Het
Gm29776 G T 14: 54,695,659 Q356K noncoding transcript Het
Gm35315 G T 5: 110,078,544 T343K probably benign Het
Gpr141 A G 13: 19,752,527 I26T probably benign Het
Hectd4 T G 5: 121,308,878 V311G possibly damaging Het
Ino80d C T 1: 63,079,047 E322K possibly damaging Het
Irs2 A G 8: 11,005,121 S1104P probably damaging Het
Lama1 T C 17: 67,790,856 F1744L probably benign Het
Lcn10 A T 2: 25,683,575 R55* probably null Het
Lrp2 A T 2: 69,469,478 C3077S probably damaging Het
Mdc1 T A 17: 35,850,674 S826R probably benign Het
Nr2c1 G T 10: 94,163,786 V103L probably benign Het
Nup133 A T 8: 123,936,873 D310E possibly damaging Het
Olfr1356 A G 10: 78,847,259 S219P possibly damaging Het
Reln T C 5: 21,948,596 K2237E probably damaging Het
Sirt2 A G 7: 28,767,515 probably benign Het
Slit2 A T 5: 48,302,428 H1350L possibly damaging Het
Snx15 A G 19: 6,121,508 S179P probably damaging Het
Sp8 T G 12: 118,848,667 S86A probably benign Het
Sptbn5 T C 2: 120,077,322 probably benign Het
Tfap4 A G 16: 4,547,311 S196P probably damaging Het
Tgm3 T C 2: 130,038,610 probably null Het
Tnks2 T C 19: 36,866,204 probably benign Het
Ttll11 A T 2: 35,752,499 probably null Het
Vwa3b C A 1: 37,100,698 Q367K possibly damaging Het
Zdhhc20 A T 14: 57,840,883 V312E probably damaging Het
Other mutations in Pip5k1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02642:Pip5k1b APN 19 24346367 missense probably benign 0.00
R0109:Pip5k1b UTSW 19 24379047 missense probably benign
R0109:Pip5k1b UTSW 19 24379047 missense probably benign
R0726:Pip5k1b UTSW 19 24378892 missense probably damaging 0.99
R1737:Pip5k1b UTSW 19 24397040 missense probably damaging 1.00
R2211:Pip5k1b UTSW 19 24378850 missense probably damaging 1.00
R2280:Pip5k1b UTSW 19 24378947 missense probably damaging 1.00
R2281:Pip5k1b UTSW 19 24378947 missense probably damaging 1.00
R4703:Pip5k1b UTSW 19 24355153 missense probably damaging 1.00
R4953:Pip5k1b UTSW 19 24390435 missense probably damaging 1.00
R5341:Pip5k1b UTSW 19 24304076 missense probably benign 0.00
R5493:Pip5k1b UTSW 19 24439075 missense probably benign
R5514:Pip5k1b UTSW 19 24350141 missense probably damaging 0.99
R5908:Pip5k1b UTSW 19 24397137 missense possibly damaging 0.95
R6083:Pip5k1b UTSW 19 24304035 nonsense probably null
R7009:Pip5k1b UTSW 19 24359935 splice site probably null
R7097:Pip5k1b UTSW 19 24358060 missense probably damaging 1.00
R7167:Pip5k1b UTSW 19 24397069 missense probably benign
R7682:Pip5k1b UTSW 19 24359979 missense probably damaging 1.00
R7892:Pip5k1b UTSW 19 24360093 missense probably benign 0.01
R7975:Pip5k1b UTSW 19 24360093 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGGTATTGACATGCCAC -3'
(R):5'- CATTGTGGCTCATTGGAGAAC -3'

Sequencing Primer
(F):5'- GCCAGAGCTCAGTTTATCAGGTC -3'
(R):5'- GGCTCATTGGAGAACATTTCC -3'
Posted On2018-02-27