Mutagenetix > Incidental Mutations

Incidental Mutation 'R6220:Rasgrp1'

503933

Institutional Source

Beutler Lab

Gene Symbol

Rasgrp1

Ensembl Gene

ENSMUSG00000027347

Gene Name

RAS guanyl releasing protein 1

Synonyms

MMRRC Submission

044352-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R6220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

117279993-117343001 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 117284929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 726 (W726*)

Ref Sequence

ENSEMBL: ENSMUSP00000136423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102534] [ENSMUST00000172901] [ENSMUST00000173252] [ENSMUST00000173541] [ENSMUST00000174770] [ENSMUST00000178884]

AlphaFold

Q9Z1S3

Predicted Effect

probably null
Transcript: ENSMUST00000102534
AA Change: W726*

SMART Domains

Protein: ENSMUSP00000099593
Gene: ENSMUSG00000027347
AA Change: W726*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
Pfam:EF-hand_6	474	502	5e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000172901

SMART Domains

Protein: ENSMUSP00000133449
Gene: ENSMUSG00000027347

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.2e-5	PFAM
C1	507	556	5.77e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173252

SMART Domains

Protein: ENSMUSP00000134592
Gene: ENSMUSG00000027347

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_6	442	467	1.1e-5	PFAM
Pfam:C1_1	507	539	3.4e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000173541
AA Change: W691*

SMART Domains

Protein: ENSMUSP00000134027
Gene: ENSMUSG00000027347
AA Change: W691*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	441	464	1.6e-5	PFAM
Pfam:EF-hand_6	442	467	1.6e-5	PFAM
C1	507	556	5.77e-16	SMART
PDB:4L9U\|B	705	756	2e-23	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000174770

SMART Domains

Protein: ENSMUSP00000134167
Gene: ENSMUSG00000027347

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000178884
AA Change: W726*

SMART Domains

Protein: ENSMUSP00000136423
Gene: ENSMUSG00000027347
AA Change: W726*

Domain	Start	End	E-Value	Type
RasGEFN	52	176	1.65e-33	SMART
RasGEF	201	437	1.64e-96	SMART
Pfam:EF-hand_5	474	499	3.2e-6	PFAM
C1	542	591	5.77e-16	SMART
PDB:4L9U\|B	740	791	2e-23	PDB

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of genes characterized by the presence of a Ras superfamily guanine nucleotide exchange factor (GEF) domain. It functions as a diacylglycerol (DAG)-regulated nucleotide exchange factor specifically activating Ras through the exchange of bound GDP for GTP. It activates the Erk/MAP kinase cascade and regulates T-cells and B-cells development, homeostasis and differentiation. Alternatively spliced transcript variants encoding different isoforms have been identified. Altered expression of the different isoforms of this protein may be a cause of susceptibility to systemic lupus erythematosus (SLE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous and targeted null mutations exhibit a lymphoproliferative autoimmune syndrome in which T cells fail to activate Ras or proliferate after antigen exposure, defects in positive selection, and enlarged spleen and lymph nodes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,846,115	E618G	possibly damaging	Het
Abhd16b	A	G	2: 181,493,785	D160G	probably damaging	Het
Acap1	A	G	11: 69,889,679	F15S	probably damaging	Het
Adam30	A	T	3: 98,161,309	S153C	probably damaging	Het
Afp	A	T	5: 90,504,410	D420V	possibly damaging	Het
Ak9	T	A	10: 41,370,099	H729Q	unknown	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bcr	A	G	10: 75,062,292	T423A	probably benign	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ctns	T	C	11: 73,193,128	T23A	probably benign	Het
Ddx54	T	A	5: 120,620,689	N332K	probably benign	Het
Dysf	T	A	6: 84,149,745	I1344N	probably damaging	Het
Elovl3	A	T	19: 46,134,500	M172L	probably benign	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Filip1l	T	A	16: 57,569,989	N313K	probably benign	Het
Foxp2	C	A	6: 15,437,948	T716K	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10645	A	G	8: 83,165,757		probably benign	Het
Gm10735	T	C	13: 113,041,496		probably benign	Het
Gm4847	A	T	1: 166,634,972	D316E	probably damaging	Het
Gorasp2	T	C	2: 70,690,790	L388P	probably damaging	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Herc1	A	G	9: 66,433,788	Y1729C	probably damaging	Het
Ifi207	A	T	1: 173,729,546	L542H	probably damaging	Het
Ighv3-5	T	A	12: 114,262,718	N96I	probably damaging	Het
Isl1	T	C	13: 116,303,267	T182A	probably benign	Het
Jph4	T	C	14: 55,110,085	E421G	probably benign	Het
Lrrc45	T	C	11: 120,719,527	I488T	probably benign	Het
Mroh8	A	G	2: 157,233,163	I471T	probably benign	Het
Ms4a2	A	T	19: 11,617,563	D96E	probably damaging	Het
Mst1r	T	A	9: 107,907,348	N68K	probably benign	Het
Myo18b	A	G	5: 112,757,507	M2075T	possibly damaging	Het
Neb	T	C	2: 52,270,972	K2229R	probably null	Het
Nkx6-3	T	A	8: 23,153,971		probably null	Het
Nlrp1a	C	A	11: 71,142,338	S10I	probably benign	Het
Npas2	A	T	1: 39,336,061	T487S	probably benign	Het
Nrxn1	G	C	17: 91,088,476	T84R	probably benign	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh18	A	G	3: 49,745,251	C921R	probably damaging	Het
Pcdha9	A	G	18: 36,998,478	Y200C	probably damaging	Het
Pknox1	A	T	17: 31,603,203	R315*	probably null	Het
Rassf8	G	A	6: 145,817,133	R402H	probably damaging	Het
Rev3l	T	A	10: 39,822,779	Y1091N	probably damaging	Het
Riok3	T	G	18: 12,149,551	V349G	probably damaging	Het
Rps18	A	T	17: 33,955,136	V15E	probably damaging	Het
Rptor	A	T	11: 119,897,442	Y1323F	possibly damaging	Het
Rspry1	T	C	8: 94,658,750	C437R	probably damaging	Het
Sema5a	T	A	15: 32,686,729	Y996N	probably damaging	Het
Smarcad1	A	G	6: 65,114,329	I1011M	probably benign	Het
Supv3l1	A	T	10: 62,439,021	M295K	possibly damaging	Het
Sv2c	T	C	13: 95,976,626	D605G	probably damaging	Het
Teddm1b	G	A	1: 153,875,201	W252*	probably null	Het
Tes	T	A	6: 17,086,196	C29*	probably null	Het
Thsd4	A	G	9: 59,982,747	W856R	probably damaging	Het
Treml4	A	T	17: 48,264,848	D93V	possibly damaging	Het
Trim66	T	C	7: 109,483,093	T218A	probably damaging	Het
Tssk5	T	C	15: 76,373,773	D128G	probably damaging	Het
Ubr3	T	A	2: 70,020,475	W1746R	probably damaging	Het
Vmn2r11	T	C	5: 109,053,568	I357V	probably benign	Het
Vmn2r87	A	T	10: 130,479,938	D86E	probably benign	Het
Zfp184	T	G	13: 21,960,207	H694Q	probably damaging	Het
Zranb3	A	C	1: 127,999,404	F341L	probably benign	Het

Other mutations in Rasgrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Rasgrp1	APN	2	117305791	nonsense	probably null
IGL00901:Rasgrp1	APN	2	117285130	missense	probably damaging	0.96
IGL01083:Rasgrp1	APN	2	117285068	missense	probably benign	0.22
IGL01325:Rasgrp1	APN	2	117298529	missense	probably damaging	1.00
IGL01520:Rasgrp1	APN	2	117288663	missense	probably damaging	1.00
IGL01776:Rasgrp1	APN	2	117286840	critical splice donor site	probably null
IGL01780:Rasgrp1	APN	2	117284878	missense	probably benign	0.00
IGL01859:Rasgrp1	APN	2	117289418	missense	probably benign	0.00
IGL01892:Rasgrp1	APN	2	117293842	missense	probably damaging	1.00
IGL02068:Rasgrp1	APN	2	117300578	splice site	probably benign
IGL02684:Rasgrp1	APN	2	117282576	missense	probably benign	0.03
bukhansan	UTSW	2	117291697	missense	possibly damaging	0.78
grouper	UTSW	2	117302004	nonsense	probably null
Gyeryandsan	UTSW	2	117287943	missense	probably damaging	1.00
Haddock	UTSW	2	117291895	missense	probably damaging	0.99
jovial	UTSW	2	117288677	missense	probably benign	0.01
mercurial	UTSW	2	117287833	nonsense	probably null
naejangsan	UTSW	2	117291792	nonsense	probably null
sea_bass	UTSW	2	117282654	missense	probably benign	0.02
venutian	UTSW	2	117284929	nonsense	probably null
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0067:Rasgrp1	UTSW	2	117294820	missense	probably damaging	1.00
R0538:Rasgrp1	UTSW	2	117284947	missense	probably benign	0.42
R0786:Rasgrp1	UTSW	2	117300499	missense	probably benign
R1068:Rasgrp1	UTSW	2	117282576	missense	probably benign	0.03
R1165:Rasgrp1	UTSW	2	117284939	missense	possibly damaging	0.49
R1491:Rasgrp1	UTSW	2	117282619	nonsense	probably null
R1707:Rasgrp1	UTSW	2	117298547	missense	probably damaging	1.00
R1869:Rasgrp1	UTSW	2	117290347	missense	probably damaging	1.00
R2214:Rasgrp1	UTSW	2	117285165	missense	probably damaging	0.98
R2425:Rasgrp1	UTSW	2	117289450	critical splice acceptor site	probably null
R3236:Rasgrp1	UTSW	2	117291812	missense	probably benign	0.00
R3915:Rasgrp1	UTSW	2	117288641	missense	probably damaging	1.00
R4079:Rasgrp1	UTSW	2	117285029	missense	probably benign	0.19
R4163:Rasgrp1	UTSW	2	117282654	missense	probably benign	0.02
R4781:Rasgrp1	UTSW	2	117291709	missense	probably benign	0.04
R4782:Rasgrp1	UTSW	2	117284875	missense	probably benign	0.00
R5028:Rasgrp1	UTSW	2	117302004	nonsense	probably null
R6019:Rasgrp1	UTSW	2	117291895	missense	probably damaging	0.99
R6294:Rasgrp1	UTSW	2	117291792	nonsense	probably null
R6335:Rasgrp1	UTSW	2	117293870	missense	probably damaging	0.99
R6948:Rasgrp1	UTSW	2	117298604	missense	probably damaging	0.99
R7165:Rasgrp1	UTSW	2	117338404	missense	probably benign	0.02
R7246:Rasgrp1	UTSW	2	117338354	nonsense	probably null
R7372:Rasgrp1	UTSW	2	117285154	missense	probably benign	0.01
R7400:Rasgrp1	UTSW	2	117298545	missense	probably damaging	1.00
R7432:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7448:Rasgrp1	UTSW	2	117291697	missense	possibly damaging	0.78
R7449:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7450:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7475:Rasgrp1	UTSW	2	117286108	missense	probably benign
R7487:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7573:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R7672:Rasgrp1	UTSW	2	117287943	missense	probably damaging	1.00
R8016:Rasgrp1	UTSW	2	117287833	nonsense	probably null
R8199:Rasgrp1	UTSW	2	117293812	missense	probably damaging	1.00
R8527:Rasgrp1	UTSW	2	117338304	missense	probably benign	0.07
R8692:Rasgrp1	UTSW	2	117284872	missense	probably damaging	0.97
R8725:Rasgrp1	UTSW	2	117288677	missense	probably benign	0.01
R8727:Rasgrp1	UTSW	2	117288677	missense	probably benign	0.01
R8880:Rasgrp1	UTSW	2	117284944	missense	probably benign	0.01
R9280:Rasgrp1	UTSW	2	117282651	missense	probably benign	0.03
Z1176:Rasgrp1	UTSW	2	117301974	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGTCTGCTGACCTAACCTAG -3'
(R):5'- CCCAGAAAATTTCAGTTCGGC -3'

Sequencing Primer
(F):5'- GCTGACCTAACCTAGTAATCATCTTG -3'
(R):5'- TGAAGAGGACTGTTGCCCAC -3'

Posted On

2018-02-27