Mutagenetix > Incidental Mutation

Incidental Mutation 'R6220:Pcdh18'

503936

Institutional Source

Beutler Lab

Gene Symbol

Pcdh18

Ensembl Gene

ENSMUSG00000037892

Gene Name

protocadherin 18

Synonyms

PCDH68L

MMRRC Submission

044352-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49743296-49757325 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 49745251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 921 (C921R)

Ref Sequence

ENSEMBL: ENSMUSP00000039245 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035931] [ENSMUST00000191794]

AlphaFold

Q8VHR0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035931
AA Change: C921R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039245
Gene: ENSMUSG00000037892
AA Change: C921R

Domain	Start	End	E-Value	Type
low complexity region	12	21	N/A	INTRINSIC
CA	51	135	1.36e-1	SMART
CA	159	244	3.78e-20	SMART
CA	268	352	1.12e-22	SMART
CA	382	463	5.76e-25	SMART
CA	487	574	2.51e-25	SMART
CA	603	684	8e-3	SMART
transmembrane domain	698	720	N/A	INTRINSIC
low complexity region	772	783	N/A	INTRINSIC
low complexity region	988	1009	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000191794

SMART Domains

Protein: ENSMUSP00000141995
Gene: ENSMUSG00000037892

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	51	135	6.6e-4	SMART
CA	159	244	1.9e-22	SMART
CA	268	352	5.6e-25	SMART
CA	382	463	2.7e-27	SMART
CA	487	574	1.2e-27	SMART
CA	603	684	3.9e-5	SMART
transmembrane domain	698	720	N/A	INTRINSIC
low complexity region	772	783	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193600

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,846,115	E618G	possibly damaging	Het
Abhd16b	A	G	2: 181,493,785	D160G	probably damaging	Het
Acap1	A	G	11: 69,889,679	F15S	probably damaging	Het
Adam30	A	T	3: 98,161,309	S153C	probably damaging	Het
Afp	A	T	5: 90,504,410	D420V	possibly damaging	Het
Ak9	T	A	10: 41,370,099	H729Q	unknown	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bcr	A	G	10: 75,062,292	T423A	probably benign	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ctns	T	C	11: 73,193,128	T23A	probably benign	Het
Ddx54	T	A	5: 120,620,689	N332K	probably benign	Het
Dysf	T	A	6: 84,149,745	I1344N	probably damaging	Het
Elovl3	A	T	19: 46,134,500	M172L	probably benign	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Filip1l	T	A	16: 57,569,989	N313K	probably benign	Het
Foxp2	C	A	6: 15,437,948	T716K	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10645	A	G	8: 83,165,757		probably benign	Het
Gm10735	T	C	13: 113,041,496		probably benign	Het
Gm4847	A	T	1: 166,634,972	D316E	probably damaging	Het
Gorasp2	T	C	2: 70,690,790	L388P	probably damaging	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Herc1	A	G	9: 66,433,788	Y1729C	probably damaging	Het
Ifi207	A	T	1: 173,729,546	L542H	probably damaging	Het
Ighv3-5	T	A	12: 114,262,718	N96I	probably damaging	Het
Isl1	T	C	13: 116,303,267	T182A	probably benign	Het
Jph4	T	C	14: 55,110,085	E421G	probably benign	Het
Lrrc45	T	C	11: 120,719,527	I488T	probably benign	Het
Mroh8	A	G	2: 157,233,163	I471T	probably benign	Het
Ms4a2	A	T	19: 11,617,563	D96E	probably damaging	Het
Mst1r	T	A	9: 107,907,348	N68K	probably benign	Het
Myo18b	A	G	5: 112,757,507	M2075T	possibly damaging	Het
Neb	T	C	2: 52,270,972	K2229R	probably null	Het
Nkx6-3	T	A	8: 23,153,971		probably null	Het
Nlrp1a	C	A	11: 71,142,338	S10I	probably benign	Het
Npas2	A	T	1: 39,336,061	T487S	probably benign	Het
Nrxn1	G	C	17: 91,088,476	T84R	probably benign	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdha9	A	G	18: 36,998,478	Y200C	probably damaging	Het
Pknox1	A	T	17: 31,603,203	R315*	probably null	Het
Rasgrp1	C	T	2: 117,284,929	W726*	probably null	Het
Rassf8	G	A	6: 145,817,133	R402H	probably damaging	Het
Rev3l	T	A	10: 39,822,779	Y1091N	probably damaging	Het
Riok3	T	G	18: 12,149,551	V349G	probably damaging	Het
Rps18	A	T	17: 33,955,136	V15E	probably damaging	Het
Rptor	A	T	11: 119,897,442	Y1323F	possibly damaging	Het
Rspry1	T	C	8: 94,658,750	C437R	probably damaging	Het
Sema5a	T	A	15: 32,686,729	Y996N	probably damaging	Het
Smarcad1	A	G	6: 65,114,329	I1011M	probably benign	Het
Supv3l1	A	T	10: 62,439,021	M295K	possibly damaging	Het
Sv2c	T	C	13: 95,976,626	D605G	probably damaging	Het
Teddm1b	G	A	1: 153,875,201	W252*	probably null	Het
Tes	T	A	6: 17,086,196	C29*	probably null	Het
Thsd4	A	G	9: 59,982,747	W856R	probably damaging	Het
Treml4	A	T	17: 48,264,848	D93V	possibly damaging	Het
Trim66	T	C	7: 109,483,093	T218A	probably damaging	Het
Tssk5	T	C	15: 76,373,773	D128G	probably damaging	Het
Ubr3	T	A	2: 70,020,475	W1746R	probably damaging	Het
Vmn2r11	T	C	5: 109,053,568	I357V	probably benign	Het
Vmn2r87	A	T	10: 130,479,938	D86E	probably benign	Het
Zfp184	T	G	13: 21,960,207	H694Q	probably damaging	Het
Zranb3	A	C	1: 127,999,404	F341L	probably benign	Het

Other mutations in Pcdh18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00543:Pcdh18	APN	3	49753379	missense	probably damaging	1.00
IGL00639:Pcdh18	APN	3	49755616	missense	probably benign	0.34
IGL00954:Pcdh18	APN	3	49756389	missense	probably damaging	1.00
IGL01338:Pcdh18	APN	3	49756141	missense	probably damaging	1.00
IGL01339:Pcdh18	APN	3	49755798	missense	probably benign	0.35
IGL01687:Pcdh18	APN	3	49753533	splice site	probably benign
IGL01727:Pcdh18	APN	3	49755700	missense	probably damaging	0.99
IGL01788:Pcdh18	APN	3	49755922	nonsense	probably null
IGL01824:Pcdh18	APN	3	49754774	missense	probably damaging	1.00
IGL01834:Pcdh18	APN	3	49756830	missense	probably benign	0.03
IGL01913:Pcdh18	APN	3	49755249	missense	possibly damaging	0.94
IGL01915:Pcdh18	APN	3	49744921	missense	probably benign
IGL02095:Pcdh18	APN	3	49756156	missense	probably benign	0.01
IGL02128:Pcdh18	APN	3	49756686	missense	possibly damaging	0.65
IGL02302:Pcdh18	APN	3	49755938	missense	probably benign
IGL02342:Pcdh18	APN	3	49756044	missense	probably damaging	1.00
IGL02440:Pcdh18	APN	3	49744603	utr 3 prime	probably benign
IGL02499:Pcdh18	APN	3	49753447	missense	probably benign	0.15
IGL02570:Pcdh18	APN	3	49756625	missense	probably benign	0.02
IGL02745:Pcdh18	APN	3	49755891	missense	probably damaging	1.00
IGL03073:Pcdh18	APN	3	49753367	missense	possibly damaging	0.93
PIT4469001:Pcdh18	UTSW	3	49755069	missense	probably benign
R0078:Pcdh18	UTSW	3	49756344	missense	probably damaging	1.00
R0196:Pcdh18	UTSW	3	49756698	splice site	probably null
R0524:Pcdh18	UTSW	3	49755642	missense	probably damaging	0.98
R0661:Pcdh18	UTSW	3	49753318	missense	possibly damaging	0.64
R0900:Pcdh18	UTSW	3	49756803	missense	probably benign	0.25
R1101:Pcdh18	UTSW	3	49753379	missense	probably damaging	1.00
R1463:Pcdh18	UTSW	3	49755405	missense	probably damaging	0.99
R1778:Pcdh18	UTSW	3	49755634	missense	probably benign	0.19
R1850:Pcdh18	UTSW	3	49756405	missense	probably benign	0.22
R1875:Pcdh18	UTSW	3	49754705	missense	probably damaging	0.99
R1903:Pcdh18	UTSW	3	49755447	missense	probably benign
R1956:Pcdh18	UTSW	3	49755951	missense	probably benign
R2044:Pcdh18	UTSW	3	49754940	missense	probably benign
R2303:Pcdh18	UTSW	3	49755274	missense	probably damaging	1.00
R3732:Pcdh18	UTSW	3	49754791	missense	probably benign
R3732:Pcdh18	UTSW	3	49754791	missense	probably benign
R3733:Pcdh18	UTSW	3	49754791	missense	probably benign
R3973:Pcdh18	UTSW	3	49754586	missense	probably damaging	1.00
R4281:Pcdh18	UTSW	3	49756533	missense	possibly damaging	0.76
R4601:Pcdh18	UTSW	3	49744725	missense	probably damaging	1.00
R4631:Pcdh18	UTSW	3	49756441	missense	probably damaging	0.99
R4752:Pcdh18	UTSW	3	49755114	missense	probably damaging	1.00
R4840:Pcdh18	UTSW	3	49744668	missense	probably damaging	0.98
R4867:Pcdh18	UTSW	3	49754664	missense	probably damaging	1.00
R5007:Pcdh18	UTSW	3	49754457	missense	probably benign	0.23
R5039:Pcdh18	UTSW	3	49754856	missense	probably benign
R5169:Pcdh18	UTSW	3	49755966	missense	possibly damaging	0.65
R5438:Pcdh18	UTSW	3	49756016	nonsense	probably null
R5579:Pcdh18	UTSW	3	49744977	missense	probably damaging	1.00
R6000:Pcdh18	UTSW	3	49754464	missense	probably damaging	0.99
R6737:Pcdh18	UTSW	3	49755895	missense	probably damaging	0.98
R6789:Pcdh18	UTSW	3	49755915	missense	probably benign	0.00
R7011:Pcdh18	UTSW	3	49754782	missense	probably benign
R7146:Pcdh18	UTSW	3	49755822	missense	probably damaging	1.00
R7150:Pcdh18	UTSW	3	49754694	missense	probably benign	0.31
R7205:Pcdh18	UTSW	3	49755474	missense	probably benign
R7326:Pcdh18	UTSW	3	49756860	missense	probably benign
R7413:Pcdh18	UTSW	3	49744783	missense	possibly damaging	0.94
R7755:Pcdh18	UTSW	3	49754829	missense	possibly damaging	0.59
R7848:Pcdh18	UTSW	3	49755997	missense	possibly damaging	0.54
R8169:Pcdh18	UTSW	3	49745235	missense	probably damaging	1.00
R8264:Pcdh18	UTSW	3	49756581	missense	probably damaging	1.00
R8352:Pcdh18	UTSW	3	49745175	missense	possibly damaging	0.81
R8406:Pcdh18	UTSW	3	49756549	missense	probably damaging	1.00
R8452:Pcdh18	UTSW	3	49745175	missense	possibly damaging	0.81
R8489:Pcdh18	UTSW	3	49754589	missense	probably damaging	1.00
R8526:Pcdh18	UTSW	3	49755574	missense	probably damaging	1.00
R9075:Pcdh18	UTSW	3	49744890	missense	probably benign
R9285:Pcdh18	UTSW	3	49753337	missense	probably damaging	0.97
R9316:Pcdh18	UTSW	3	49754640	missense	probably damaging	1.00
R9339:Pcdh18	UTSW	3	49754886	missense	probably damaging	1.00
R9410:Pcdh18	UTSW	3	49745166	missense	probably damaging	1.00
R9425:Pcdh18	UTSW	3	49754602	missense	possibly damaging	0.81
R9432:Pcdh18	UTSW	3	49745218	missense	probably damaging	0.96
R9547:Pcdh18	UTSW	3	49755057	missense	possibly damaging	0.79
R9567:Pcdh18	UTSW	3	49756435	missense	possibly damaging	0.95
R9622:Pcdh18	UTSW	3	49756780	missense	probably benign	0.20
R9687:Pcdh18	UTSW	3	49756587	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTAGAGTCTCCCGAATCC -3'
(R):5'- CGTAGCCTATCTAATGTGCCTAAC -3'

Sequencing Primer
(F):5'- GGAGTCCTTCCCAAAAGTGG -3'
(R):5'- GCCTATCTAATGTGCCTAACAACAG -3'

Posted On

2018-02-27