Mutagenetix > Incidental Mutations

Incidental Mutation 'R6220:Adam30'

503937

Institutional Source

Beutler Lab

Gene Symbol

Adam30

Ensembl Gene

ENSMUSG00000043468

Gene Name

a disintegrin and metallopeptidase domain 30

Synonyms

4933424D07Rik

MMRRC Submission

044352-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R6220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98160630-98164169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 98161309 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 153 (S153C)

Ref Sequence

ENSEMBL: ENSMUSP00000060505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050342] [ENSMUST00000198363]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050342
AA Change: S153C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000060505
Gene: ENSMUSG00000043468
AA Change: S153C

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Pep_M12B_propep	36	159	5.7e-20	PFAM
low complexity region	176	187	N/A	INTRINSIC
Pfam:Reprolysin	202	393	1.1e-31	PFAM
DISIN	407	482	1.6e-32	SMART
ACR	483	625	1.84e-52	SMART
transmembrane domain	690	712	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000198363
AA Change: S25C

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142590
Gene: ENSMUSG00000043468
AA Change: S25C

Domain	Start	End	E-Value	Type
low complexity region	48	59	N/A	INTRINSIC
Pfam:Reprolysin_5	72	259	2.6e-6	PFAM
Pfam:Reprolysin	74	265	2.1e-29	PFAM
Pfam:Reprolysin_3	101	220	1.1e-4	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,846,115	E618G	possibly damaging	Het
Abhd16b	A	G	2: 181,493,785	D160G	probably damaging	Het
Acap1	A	G	11: 69,889,679	F15S	probably damaging	Het
Afp	A	T	5: 90,504,410	D420V	possibly damaging	Het
Ak9	T	A	10: 41,370,099	H729Q	unknown	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bcr	A	G	10: 75,062,292	T423A	probably benign	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ctns	T	C	11: 73,193,128	T23A	probably benign	Het
Ddx54	T	A	5: 120,620,689	N332K	probably benign	Het
Dysf	T	A	6: 84,149,745	I1344N	probably damaging	Het
Elovl3	A	T	19: 46,134,500	M172L	probably benign	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Filip1l	T	A	16: 57,569,989	N313K	probably benign	Het
Foxp2	C	A	6: 15,437,948	T716K	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10645	A	G	8: 83,165,757		probably benign	Het
Gm10735	T	C	13: 113,041,496		probably benign	Het
Gm4847	A	T	1: 166,634,972	D316E	probably damaging	Het
Gorasp2	T	C	2: 70,690,790	L388P	probably damaging	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Herc1	A	G	9: 66,433,788	Y1729C	probably damaging	Het
Ifi207	A	T	1: 173,729,546	L542H	probably damaging	Het
Ighv3-5	T	A	12: 114,262,718	N96I	probably damaging	Het
Isl1	T	C	13: 116,303,267	T182A	probably benign	Het
Jph4	T	C	14: 55,110,085	E421G	probably benign	Het
Lrrc45	T	C	11: 120,719,527	I488T	probably benign	Het
Mroh8	A	G	2: 157,233,163	I471T	probably benign	Het
Ms4a2	A	T	19: 11,617,563	D96E	probably damaging	Het
Mst1r	T	A	9: 107,907,348	N68K	probably benign	Het
Myo18b	A	G	5: 112,757,507	M2075T	possibly damaging	Het
Neb	T	C	2: 52,270,972	K2229R	probably null	Het
Nkx6-3	T	A	8: 23,153,971		probably null	Het
Nlrp1a	C	A	11: 71,142,338	S10I	probably benign	Het
Npas2	A	T	1: 39,336,061	T487S	probably benign	Het
Nrxn1	G	C	17: 91,088,476	T84R	probably benign	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh18	A	G	3: 49,745,251	C921R	probably damaging	Het
Pcdha9	A	G	18: 36,998,478	Y200C	probably damaging	Het
Pknox1	A	T	17: 31,603,203	R315*	probably null	Het
Rasgrp1	C	T	2: 117,284,929	W726*	probably null	Het
Rassf8	G	A	6: 145,817,133	R402H	probably damaging	Het
Rev3l	T	A	10: 39,822,779	Y1091N	probably damaging	Het
Riok3	T	G	18: 12,149,551	V349G	probably damaging	Het
Rps18	A	T	17: 33,955,136	V15E	probably damaging	Het
Rptor	A	T	11: 119,897,442	Y1323F	possibly damaging	Het
Rspry1	T	C	8: 94,658,750	C437R	probably damaging	Het
Sema5a	T	A	15: 32,686,729	Y996N	probably damaging	Het
Smarcad1	A	G	6: 65,114,329	I1011M	probably benign	Het
Supv3l1	A	T	10: 62,439,021	M295K	possibly damaging	Het
Sv2c	T	C	13: 95,976,626	D605G	probably damaging	Het
Teddm1b	G	A	1: 153,875,201	W252*	probably null	Het
Tes	T	A	6: 17,086,196	C29*	probably null	Het
Thsd4	A	G	9: 59,982,747	W856R	probably damaging	Het
Treml4	A	T	17: 48,264,848	D93V	possibly damaging	Het
Trim66	T	C	7: 109,483,093	T218A	probably damaging	Het
Tssk5	T	C	15: 76,373,773	D128G	probably damaging	Het
Ubr3	T	A	2: 70,020,475	W1746R	probably damaging	Het
Vmn2r11	T	C	5: 109,053,568	I357V	probably benign	Het
Vmn2r87	A	T	10: 130,479,938	D86E	probably benign	Het
Zfp184	T	G	13: 21,960,207	H694Q	probably damaging	Het
Zranb3	A	C	1: 127,999,404	F341L	probably benign	Het

Other mutations in Adam30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Adam30	APN	3	98162170	missense	probably benign	0.01
IGL01630:Adam30	APN	3	98161855	missense	possibly damaging	0.83
IGL01825:Adam30	APN	3	98161901	missense	probably damaging	0.96
IGL02033:Adam30	APN	3	98161471	missense	probably benign	0.13
IGL03157:Adam30	APN	3	98162296	missense	possibly damaging	0.85
IGL03330:Adam30	APN	3	98162456	missense	probably damaging	1.00
R0512:Adam30	UTSW	3	98162125	missense	probably damaging	1.00
R1082:Adam30	UTSW	3	98162290	missense	probably benign	0.30
R1173:Adam30	UTSW	3	98162906	missense	probably benign	0.07
R1463:Adam30	UTSW	3	98162525	missense	probably damaging	1.00
R1771:Adam30	UTSW	3	98161519	missense	possibly damaging	0.94
R1862:Adam30	UTSW	3	98162113	nonsense	probably null
R3442:Adam30	UTSW	3	98162570	missense	probably benign	0.35
R4125:Adam30	UTSW	3	98161363	missense	probably damaging	1.00
R4714:Adam30	UTSW	3	98162854	missense	probably damaging	1.00
R4816:Adam30	UTSW	3	98162745	missense	possibly damaging	0.68
R5447:Adam30	UTSW	3	98161343	missense	probably benign	0.09
R5958:Adam30	UTSW	3	98161964	missense	probably damaging	1.00
R6175:Adam30	UTSW	3	98162950	missense	probably damaging	1.00
R6338:Adam30	UTSW	3	98161541	missense	probably damaging	1.00
R6365:Adam30	UTSW	3	98161034	missense	probably damaging	0.99
R6998:Adam30	UTSW	3	98162710	missense	probably benign	0.03
R7086:Adam30	UTSW	3	98161319	missense	probably damaging	1.00
R7290:Adam30	UTSW	3	98162941	missense	probably benign	0.00
R7340:Adam30	UTSW	3	98162321	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CTTCACTCAAGAGGGCAGTC -3'
(R):5'- CCTAGACATATTGCCACGGG -3'

Sequencing Primer
(F):5'- CAGTCTGATAGAGGATTATCCGC -3'
(R):5'- GGGCAAACACGAATCTATCCAGG -3'

Posted On

2018-02-27