Incidental Mutation 'R6220:Adam30'
ID503937
Institutional Source Beutler Lab
Gene Symbol Adam30
Ensembl Gene ENSMUSG00000043468
Gene Namea disintegrin and metallopeptidase domain 30
Synonyms4933424D07Rik
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location98160630-98164169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98161309 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 153 (S153C)
Ref Sequence ENSEMBL: ENSMUSP00000060505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050342] [ENSMUST00000198363]
Predicted Effect probably damaging
Transcript: ENSMUST00000050342
AA Change: S153C

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060505
Gene: ENSMUSG00000043468
AA Change: S153C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 159 5.7e-20 PFAM
low complexity region 176 187 N/A INTRINSIC
Pfam:Reprolysin 202 393 1.1e-31 PFAM
DISIN 407 482 1.6e-32 SMART
ACR 483 625 1.84e-52 SMART
transmembrane domain 690 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198363
AA Change: S25C

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142590
Gene: ENSMUSG00000043468
AA Change: S25C

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:Reprolysin_5 72 259 2.6e-6 PFAM
Pfam:Reprolysin 74 265 2.1e-29 PFAM
Pfam:Reprolysin_3 101 220 1.1e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. This gene is testis-specific and contains a polymorphic region, resulting in isoforms with varying numbers of C-terminal repeats. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Adam30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Adam30 APN 3 98162170 missense probably benign 0.01
IGL01630:Adam30 APN 3 98161855 missense possibly damaging 0.83
IGL01825:Adam30 APN 3 98161901 missense probably damaging 0.96
IGL02033:Adam30 APN 3 98161471 missense probably benign 0.13
IGL03157:Adam30 APN 3 98162296 missense possibly damaging 0.85
IGL03330:Adam30 APN 3 98162456 missense probably damaging 1.00
R0512:Adam30 UTSW 3 98162125 missense probably damaging 1.00
R1082:Adam30 UTSW 3 98162290 missense probably benign 0.30
R1173:Adam30 UTSW 3 98162906 missense probably benign 0.07
R1463:Adam30 UTSW 3 98162525 missense probably damaging 1.00
R1771:Adam30 UTSW 3 98161519 missense possibly damaging 0.94
R1862:Adam30 UTSW 3 98162113 nonsense probably null
R3442:Adam30 UTSW 3 98162570 missense probably benign 0.35
R4125:Adam30 UTSW 3 98161363 missense probably damaging 1.00
R4714:Adam30 UTSW 3 98162854 missense probably damaging 1.00
R4816:Adam30 UTSW 3 98162745 missense possibly damaging 0.68
R5447:Adam30 UTSW 3 98161343 missense probably benign 0.09
R5958:Adam30 UTSW 3 98161964 missense probably damaging 1.00
R6175:Adam30 UTSW 3 98162950 missense probably damaging 1.00
R6338:Adam30 UTSW 3 98161541 missense probably damaging 1.00
R6365:Adam30 UTSW 3 98161034 missense probably damaging 0.99
R6998:Adam30 UTSW 3 98162710 missense probably benign 0.03
R7086:Adam30 UTSW 3 98161319 missense probably damaging 1.00
R7290:Adam30 UTSW 3 98162941 missense probably benign 0.00
R7340:Adam30 UTSW 3 98162321 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTTCACTCAAGAGGGCAGTC -3'
(R):5'- CCTAGACATATTGCCACGGG -3'

Sequencing Primer
(F):5'- CAGTCTGATAGAGGATTATCCGC -3'
(R):5'- GGGCAAACACGAATCTATCCAGG -3'
Posted On2018-02-27