Incidental Mutation 'R6220:Cc2d1b'
ID503938
Institutional Source Beutler Lab
Gene Symbol Cc2d1b
Ensembl Gene ENSMUSG00000028582
Gene Namecoiled-coil and C2 domain containing 1B
SynonymsFreud2, A830039B04Rik
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108619940-108634123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108633225 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 825 (R825W)
Ref Sequence ENSEMBL: ENSMUSP00000030320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030320] [ENSMUST00000106657] [ENSMUST00000106658]
Predicted Effect probably damaging
Transcript: ENSMUST00000030320
AA Change: R825W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030320
Gene: ENSMUSG00000028582
AA Change: R825W

DomainStartEndE-ValueType
low complexity region 39 59 N/A INTRINSIC
low complexity region 90 110 N/A INTRINSIC
DM14 167 224 1.11e-20 SMART
DM14 278 335 5.07e-24 SMART
low complexity region 370 382 N/A INTRINSIC
DM14 383 441 8.62e-27 SMART
low complexity region 487 498 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
DM14 527 585 6.44e-26 SMART
coiled coil region 604 626 N/A INTRINSIC
C2 690 804 8.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106657
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106658
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126156
Predicted Effect unknown
Transcript: ENSMUST00000134844
AA Change: R746W
SMART Domains Protein: ENSMUSP00000123277
Gene: ENSMUSG00000028582
AA Change: R746W

DomainStartEndE-ValueType
low complexity region 31 51 N/A INTRINSIC
DM14 108 165 1.11e-20 SMART
DM14 200 257 5.07e-24 SMART
low complexity region 292 304 N/A INTRINSIC
DM14 305 363 8.62e-27 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
DM14 449 507 6.44e-26 SMART
coiled coil region 525 547 N/A INTRINSIC
C2 612 726 8.05e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176877
Meta Mutation Damage Score 0.9184 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Cc2d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cc2d1b APN 4 108627378 missense probably damaging 1.00
IGL00507:Cc2d1b APN 4 108629730 missense probably damaging 1.00
IGL00596:Cc2d1b APN 4 108627306 missense probably damaging 1.00
IGL02800:Cc2d1b APN 4 108626136 missense probably benign 0.00
IGL02937:Cc2d1b APN 4 108631894 missense probably damaging 1.00
R0440:Cc2d1b UTSW 4 108625816 critical splice donor site probably null
R1513:Cc2d1b UTSW 4 108633226 missense probably damaging 1.00
R1592:Cc2d1b UTSW 4 108626671 unclassified probably benign
R1663:Cc2d1b UTSW 4 108623547 missense probably damaging 1.00
R4235:Cc2d1b UTSW 4 108625352 intron probably benign
R4361:Cc2d1b UTSW 4 108624750 intron probably benign
R4739:Cc2d1b UTSW 4 108628042 missense probably benign 0.02
R5068:Cc2d1b UTSW 4 108623464 missense possibly damaging 0.92
R5152:Cc2d1b UTSW 4 108626086 missense probably benign 0.10
R5271:Cc2d1b UTSW 4 108623629 intron probably benign
R5520:Cc2d1b UTSW 4 108626359 missense possibly damaging 0.53
R6196:Cc2d1b UTSW 4 108633225 missense probably damaging 1.00
R6197:Cc2d1b UTSW 4 108633225 missense probably damaging 1.00
R6198:Cc2d1b UTSW 4 108633225 missense probably damaging 1.00
R6299:Cc2d1b UTSW 4 108628138 missense probably benign 0.01
R7244:Cc2d1b UTSW 4 108629602 missense probably benign 0.32
R7293:Cc2d1b UTSW 4 108631676 missense probably benign 0.40
R8105:Cc2d1b UTSW 4 108627933 missense possibly damaging 0.87
R8835:Cc2d1b UTSW 4 108627067 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCATATTGCAGGAAGAAGGC -3'
(R):5'- TTCCTGCCCCAAGTCTACTGAG -3'

Sequencing Primer
(F):5'- AAGGCTGGGCTCTCCTGAAG -3'
(R):5'- GCCCCAAGTCTACTGAGGAACTTTAG -3'
Posted On2018-02-27