Incidental Mutation 'R6220:Fbxo6'
ID503939
Institutional Source Beutler Lab
Gene Symbol Fbxo6
Ensembl Gene ENSMUSG00000055401
Gene NameF-box protein 6
SynonymsFbx6b, FBG2, Fbs2, Fbxo6b
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148145716-148152140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 148149522 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 39 (I39N)
Ref Sequence ENSEMBL: ENSMUSP00000130188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000030860] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000084129] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000105707] [ENSMUST00000126615] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000132698] [ENSMUST00000134261] [ENSMUST00000152098] [ENSMUST00000168503] [ENSMUST00000172472] [ENSMUST00000151246] [ENSMUST00000167160] [ENSMUST00000140049]
Predicted Effect probably damaging
Transcript: ENSMUST00000030858
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030860
SMART Domains Protein: ENSMUSP00000030860
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 184 1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056965
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057907
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084129
SMART Domains Protein: ENSMUSP00000081146
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 167 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105705
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105706
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105707
SMART Domains Protein: ENSMUSP00000101332
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 13 171 4.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105708
Predicted Effect probably damaging
Transcript: ENSMUST00000126615
AA Change: I39N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120801
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 237 1.39e-97 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129253
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132083
AA Change: I39N
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132698
SMART Domains Protein: ENSMUSP00000122774
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
Pfam:HORMA 12 168 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134261
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152098
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168503
AA Change: I39N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401
AA Change: I39N

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183749
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151246
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167160
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140049
SMART Domains Protein: ENSMUSP00000120481
Gene: ENSMUSG00000029003

DomainStartEndE-ValueType
PDB:4FJO|C 32 107 1e-47 PDB
SCOP:d1go4a_ 32 107 1e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153703
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Meta Mutation Damage Score 0.8724 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class, and its C-terminal region is highly similar to that of rat NFB42 (neural F Box 42 kDa) which may be involved in the control of the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Fbxo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Fbxo6 APN 4 148146143 missense probably damaging 1.00
IGL00940:Fbxo6 APN 4 148146110 missense probably benign 0.05
IGL02996:Fbxo6 APN 4 148146891 missense probably damaging 1.00
IGL03034:Fbxo6 APN 4 148146122 nonsense probably null
R0556:Fbxo6 UTSW 4 148146175 missense probably damaging 1.00
R1475:Fbxo6 UTSW 4 148146110 missense probably benign 0.05
R1482:Fbxo6 UTSW 4 148145984 nonsense probably null
R1986:Fbxo6 UTSW 4 148146095 missense probably damaging 1.00
R3742:Fbxo6 UTSW 4 148149633 unclassified probably benign
R4994:Fbxo6 UTSW 4 148149491 missense probably damaging 0.99
R6102:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6103:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6104:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6105:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6129:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6130:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6212:Fbxo6 UTSW 4 148149522 missense probably damaging 1.00
R6392:Fbxo6 UTSW 4 148146005 missense probably benign 0.03
R7997:Fbxo6 UTSW 4 148147395 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCGTTAGCTAGCGTGGACAG -3'
(R):5'- GTCTGCTGTTTCAGGTCCTCAG -3'

Sequencing Primer
(F):5'- TAAAGAAGGCTCCCAGGGCTC -3'
(R):5'- TCAGGTCCTCAGCTCACTG -3'
Posted On2018-02-27