Mutagenetix > Incidental Mutations

Incidental Mutation 'R6220:Rspry1'

503952

Institutional Source

Beutler Lab

Gene Symbol

Rspry1

Ensembl Gene

ENSMUSG00000050079

Gene Name

ring finger and SPRY domain containing 1

Synonyms

4930470D19Rik

MMRRC Submission

044352-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.526) question?

Stock #

R6220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94601937-94660275 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94658750 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 437 (C437R)

Ref Sequence

ENSEMBL: ENSMUSP00000148724 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000211983] [ENSMUST00000212729]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060389
AA Change: C561R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: C561R

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	30	39	N/A	INTRINSIC
low complexity region	74	95	N/A	INTRINSIC
SPRY	358	482	2.94e-26	SMART
RING	527	561	3.93e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211941

Predicted Effect

probably damaging
Transcript: ENSMUST00000211983
AA Change: C561R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212729
AA Change: C437R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,846,115	E618G	possibly damaging	Het
Abhd16b	A	G	2: 181,493,785	D160G	probably damaging	Het
Acap1	A	G	11: 69,889,679	F15S	probably damaging	Het
Adam30	A	T	3: 98,161,309	S153C	probably damaging	Het
Afp	A	T	5: 90,504,410	D420V	possibly damaging	Het
Ak9	T	A	10: 41,370,099	H729Q	unknown	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bcr	A	G	10: 75,062,292	T423A	probably benign	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ctns	T	C	11: 73,193,128	T23A	probably benign	Het
Ddx54	T	A	5: 120,620,689	N332K	probably benign	Het
Dysf	T	A	6: 84,149,745	I1344N	probably damaging	Het
Elovl3	A	T	19: 46,134,500	M172L	probably benign	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Filip1l	T	A	16: 57,569,989	N313K	probably benign	Het
Foxp2	C	A	6: 15,437,948	T716K	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10645	A	G	8: 83,165,757		probably benign	Het
Gm10735	T	C	13: 113,041,496		probably benign	Het
Gm4847	A	T	1: 166,634,972	D316E	probably damaging	Het
Gorasp2	T	C	2: 70,690,790	L388P	probably damaging	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Herc1	A	G	9: 66,433,788	Y1729C	probably damaging	Het
Ifi207	A	T	1: 173,729,546	L542H	probably damaging	Het
Ighv3-5	T	A	12: 114,262,718	N96I	probably damaging	Het
Isl1	T	C	13: 116,303,267	T182A	probably benign	Het
Jph4	T	C	14: 55,110,085	E421G	probably benign	Het
Lrrc45	T	C	11: 120,719,527	I488T	probably benign	Het
Mroh8	A	G	2: 157,233,163	I471T	probably benign	Het
Ms4a2	A	T	19: 11,617,563	D96E	probably damaging	Het
Mst1r	T	A	9: 107,907,348	N68K	probably benign	Het
Myo18b	A	G	5: 112,757,507	M2075T	possibly damaging	Het
Neb	T	C	2: 52,270,972	K2229R	probably null	Het
Nkx6-3	T	A	8: 23,153,971		probably null	Het
Nlrp1a	C	A	11: 71,142,338	S10I	probably benign	Het
Npas2	A	T	1: 39,336,061	T487S	probably benign	Het
Nrxn1	G	C	17: 91,088,476	T84R	probably benign	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh18	A	G	3: 49,745,251	C921R	probably damaging	Het
Pcdha9	A	G	18: 36,998,478	Y200C	probably damaging	Het
Pknox1	A	T	17: 31,603,203	R315*	probably null	Het
Rasgrp1	C	T	2: 117,284,929	W726*	probably null	Het
Rassf8	G	A	6: 145,817,133	R402H	probably damaging	Het
Rev3l	T	A	10: 39,822,779	Y1091N	probably damaging	Het
Riok3	T	G	18: 12,149,551	V349G	probably damaging	Het
Rps18	A	T	17: 33,955,136	V15E	probably damaging	Het
Rptor	A	T	11: 119,897,442	Y1323F	possibly damaging	Het
Sema5a	T	A	15: 32,686,729	Y996N	probably damaging	Het
Smarcad1	A	G	6: 65,114,329	I1011M	probably benign	Het
Supv3l1	A	T	10: 62,439,021	M295K	possibly damaging	Het
Sv2c	T	C	13: 95,976,626	D605G	probably damaging	Het
Teddm1b	G	A	1: 153,875,201	W252*	probably null	Het
Tes	T	A	6: 17,086,196	C29*	probably null	Het
Thsd4	A	G	9: 59,982,747	W856R	probably damaging	Het
Treml4	A	T	17: 48,264,848	D93V	possibly damaging	Het
Trim66	T	C	7: 109,483,093	T218A	probably damaging	Het
Tssk5	T	C	15: 76,373,773	D128G	probably damaging	Het
Ubr3	T	A	2: 70,020,475	W1746R	probably damaging	Het
Vmn2r11	T	C	5: 109,053,568	I357V	probably benign	Het
Vmn2r87	A	T	10: 130,479,938	D86E	probably benign	Het
Zfp184	T	G	13: 21,960,207	H694Q	probably damaging	Het
Zranb3	A	C	1: 127,999,404	F341L	probably benign	Het

Other mutations in Rspry1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rspry1	APN	8	94622986	start codon destroyed	probably null	0.89
IGL00158:Rspry1	APN	8	94622980	intron	probably benign
IGL01141:Rspry1	APN	8	94649855	missense	probably benign	0.00
IGL01860:Rspry1	APN	8	94649816	missense	probably benign	0.00
IGL02174:Rspry1	APN	8	94633140	missense	possibly damaging	0.84
IGL02819:Rspry1	APN	8	94654256	missense	probably benign	0.42
IGL02926:Rspry1	APN	8	94649811	missense	probably damaging	1.00
IGL03366:Rspry1	APN	8	94650334	missense	probably benign	0.00
R0570:Rspry1	UTSW	8	94629792	missense	probably damaging	1.00
R1833:Rspry1	UTSW	8	94635488	missense	probably damaging	1.00
R1988:Rspry1	UTSW	8	94632054	critical splice acceptor site	probably null
R2444:Rspry1	UTSW	8	94623107	missense	probably damaging	1.00
R3623:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R3624:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R4275:Rspry1	UTSW	8	94649761	missense	probably benign	0.00
R4888:Rspry1	UTSW	8	94658789	missense	probably benign	0.19
R5026:Rspry1	UTSW	8	94650303	missense	probably damaging	1.00
R5310:Rspry1	UTSW	8	94623185	missense	probably benign
R5374:Rspry1	UTSW	8	94623008	missense	probably benign	0.00
R5374:Rspry1	UTSW	8	94654264	missense	probably benign	0.38
R5387:Rspry1	UTSW	8	94638286	missense	possibly damaging	0.95
R5517:Rspry1	UTSW	8	94636760	splice site	probably null
R5631:Rspry1	UTSW	8	94629078	start codon destroyed	possibly damaging	0.79
R5653:Rspry1	UTSW	8	94636611	splice site	probably null
R6065:Rspry1	UTSW	8	94622987	start codon destroyed	probably null	0.98
R6276:Rspry1	UTSW	8	94623258	missense	probably damaging	1.00
R6821:Rspry1	UTSW	8	94635431	nonsense	probably null
R7390:Rspry1	UTSW	8	94623185	missense	probably benign
R7460:Rspry1	UTSW	8	94650335	missense	probably benign	0.00
R7644:Rspry1	UTSW	8	94658768	missense	probably benign	0.00
R7717:Rspry1	UTSW	8	94623122	missense	probably damaging	1.00
R7768:Rspry1	UTSW	8	94629841	missense	probably damaging	1.00
R7940:Rspry1	UTSW	8	94623007	missense	probably benign	0.22
R7978:Rspry1	UTSW	8	94623125	missense	probably damaging	0.98
R8087:Rspry1	UTSW	8	94654297	missense	probably benign	0.04
R8174:Rspry1	UTSW	8	94649822	missense	probably damaging	0.97
R8326:Rspry1	UTSW	8	94639589	missense	probably damaging	1.00
R8676:Rspry1	UTSW	8	94632119	missense	probably benign	0.01
R8715:Rspry1	UTSW	8	94623260	missense	probably damaging	0.98
X0010:Rspry1	UTSW	8	94629801	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AACAACTTCTTTAGCCTACAGAGG -3'
(R):5'- TGGCCATGGCTATAAGTTTCAATG -3'

Sequencing Primer
(F):5'- GGAGGAGGATTAAAGATAAAAATGGG -3'
(R):5'- CATTGGCTGGAATTGAGTA -3'

Posted On

2018-02-27