Incidental Mutation 'R6220:Thsd4'
ID503953
Institutional Source Beutler Lab
Gene Symbol Thsd4
Ensembl Gene ENSMUSG00000032289
Gene Namethrombospondin, type I, domain containing 4
SynonymsADAMTSL6, B230114P05Rik
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location59966931-60522046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59982747 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 856 (W856R)
Ref Sequence ENSEMBL: ENSMUSP00000131418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034829] [ENSMUST00000098660] [ENSMUST00000171654]
Predicted Effect probably damaging
Transcript: ENSMUST00000034829
AA Change: W496R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034829
Gene: ENSMUSG00000032289
AA Change: W496R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ADAM_spacer1 52 168 7.8e-40 PFAM
low complexity region 189 205 N/A INTRINSIC
TSP1 261 317 1.51e-1 SMART
TSP1 319 377 8.11e-5 SMART
TSP1 379 434 7.92e-8 SMART
TSP1 436 491 1.6e-3 SMART
TSP1 495 553 4.82e-2 SMART
TSP1 556 608 1.03e-6 SMART
Pfam:PLAC 614 646 2.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098660
AA Change: W856R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096257
Gene: ENSMUSG00000032289
AA Change: W856R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 1.5e-39 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 974 1006 4.2e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171654
AA Change: W856R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131418
Gene: ENSMUSG00000032289
AA Change: W856R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 5.4e-40 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 975 1005 1.3e-12 PFAM
Meta Mutation Damage Score 0.9451 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Thsd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Thsd4 APN 9 60394115 missense probably benign 0.22
IGL02418:Thsd4 APN 9 60428315 missense probably damaging 0.99
IGL02491:Thsd4 APN 9 60000018 missense probably damaging 0.99
IGL02754:Thsd4 APN 9 59989097 splice site probably benign
IGL02874:Thsd4 APN 9 60252730 missense probably damaging 1.00
IGL02978:Thsd4 APN 9 60056846 splice site probably null
IGL03139:Thsd4 APN 9 59997173 missense probably benign 0.01
R0266:Thsd4 UTSW 9 59997134 missense probably benign 0.07
R0482:Thsd4 UTSW 9 60002978 missense probably damaging 1.00
R1188:Thsd4 UTSW 9 60394406 missense probably benign 0.12
R1447:Thsd4 UTSW 9 59997213 missense probably benign
R1572:Thsd4 UTSW 9 60394553 splice site probably benign
R1812:Thsd4 UTSW 9 60056937 missense probably damaging 1.00
R2349:Thsd4 UTSW 9 59972515 missense probably benign 0.05
R3236:Thsd4 UTSW 9 60394387 missense probably benign
R4088:Thsd4 UTSW 9 59997222 missense probably benign 0.02
R4884:Thsd4 UTSW 9 59988037 missense probably benign 0.43
R4886:Thsd4 UTSW 9 59989030 missense probably benign 0.00
R5066:Thsd4 UTSW 9 59976332 missense probably damaging 1.00
R5223:Thsd4 UTSW 9 60057042 missense probably damaging 1.00
R5441:Thsd4 UTSW 9 59979783 missense probably damaging 1.00
R5457:Thsd4 UTSW 9 59979777 missense probably damaging 1.00
R5574:Thsd4 UTSW 9 59972400 missense probably damaging 1.00
R5581:Thsd4 UTSW 9 59972458 missense possibly damaging 0.90
R5903:Thsd4 UTSW 9 60394106 missense possibly damaging 0.47
R6728:Thsd4 UTSW 9 59997197 missense probably benign
R7102:Thsd4 UTSW 9 59976304 missense probably damaging 1.00
R7316:Thsd4 UTSW 9 59987359 missense probably benign 0.00
R7403:Thsd4 UTSW 9 60056887 missense probably damaging 0.99
R7638:Thsd4 UTSW 9 60394472 missense probably damaging 1.00
R7671:Thsd4 UTSW 9 60428174 missense probably benign
R7856:Thsd4 UTSW 9 60002861 missense probably damaging 1.00
Z1177:Thsd4 UTSW 9 59988094 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACACTCAACCTTCTTGGC -3'
(R):5'- TTGGAAGGATCCCCAGAACC -3'

Sequencing Primer
(F):5'- TGACCAAGGTGAGCACGC -3'
(R):5'- GGATCCCCAGAACCTGCATG -3'
Posted On2018-02-27