Incidental Mutation 'R6220:Bcr'
ID503959
Institutional Source Beutler Lab
Gene Symbol Bcr
Ensembl Gene ENSMUSG00000009681
Gene Namebreakpoint cluster region
Synonyms5133400C09Rik
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75060592-75184921 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75062292 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 423 (T423A)
Ref Sequence ENSEMBL: ENSMUSP00000126377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164107]
Predicted Effect probably benign
Transcript: ENSMUST00000164107
AA Change: T423A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126377
Gene: ENSMUSG00000009681
AA Change: T423A

DomainStartEndE-ValueType
Pfam:Bcr-Abl_Oligo 3 75 1.2e-44 PFAM
low complexity region 86 109 N/A INTRINSIC
low complexity region 121 147 N/A INTRINSIC
low complexity region 342 358 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
RhoGEF 501 689 6.22e-51 SMART
PH 708 867 7.95e-8 SMART
C2 911 1016 2.85e-11 SMART
RhoGAP 1064 1248 6.42e-70 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A reciprocal translocation between chromosomes 22 and 9 produces the Philadelphia chromosome, which is often found in patients with chronic myelogenous leukemia. The chromosome 22 breakpoint for this translocation is located within the BCR gene. The translocation produces a fusion protein which is encoded by sequence from both BCR and ABL, the gene at the chromosome 9 breakpoint. Although the BCR-ABL fusion protein has been extensively studied, the function of the normal BCR gene product is not clear. The protein has serine/threonine kinase activity and is a GTPase-activating protein for p21rac. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are defective in hormonal and behavioral stress response regulation and prone to septic shock, whereas chimeric mice carrying a BCR-ABL fusion mutation mimicking human Philadelphia chromosome develop chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Bcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bcr APN 10 75157071 unclassified probably benign
IGL00662:Bcr APN 10 75168100 splice site probably benign
IGL01359:Bcr APN 10 75159779 unclassified probably benign
IGL01737:Bcr APN 10 75154951 missense probably damaging 0.99
IGL01908:Bcr APN 10 75061873 missense possibly damaging 0.85
IGL01954:Bcr APN 10 75175341 splice site probably null
IGL02169:Bcr APN 10 75159882 missense probably benign 0.07
IGL02379:Bcr APN 10 75157148 missense probably benign 0.02
IGL02380:Bcr APN 10 75175299 missense probably benign
IGL02385:Bcr APN 10 75145403 missense probably damaging 1.00
IGL02657:Bcr APN 10 75154964 missense probably benign 0.00
IGL02682:Bcr APN 10 75166046 missense possibly damaging 0.67
IGL02959:Bcr APN 10 75160390 missense probably benign 0.44
accrual UTSW 10 75061506 missense possibly damaging 0.77
Appreciation UTSW 10 75061125 nonsense probably null
R0329:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0330:Bcr UTSW 10 75181634 missense possibly damaging 0.88
R0376:Bcr UTSW 10 75145327 missense probably damaging 1.00
R0685:Bcr UTSW 10 75131643 missense probably damaging 1.00
R0828:Bcr UTSW 10 75157207 unclassified probably benign
R0892:Bcr UTSW 10 75125063 missense probably benign 0.00
R1143:Bcr UTSW 10 75061365 missense probably benign 0.00
R1416:Bcr UTSW 10 75061506 missense possibly damaging 0.77
R1479:Bcr UTSW 10 75061125 nonsense probably null
R1611:Bcr UTSW 10 75125202 splice site probably null
R1636:Bcr UTSW 10 75131066 missense probably damaging 1.00
R1837:Bcr UTSW 10 75168100 splice site probably benign
R2341:Bcr UTSW 10 75131112 missense probably damaging 1.00
R2343:Bcr UTSW 10 75145422 missense probably benign 0.03
R3753:Bcr UTSW 10 75135940 missense probably benign 0.05
R4273:Bcr UTSW 10 75125111 missense probably damaging 0.97
R4624:Bcr UTSW 10 75153920 missense probably damaging 1.00
R4723:Bcr UTSW 10 75175329 missense probably benign 0.45
R5013:Bcr UTSW 10 75125066 missense probably benign 0.00
R5359:Bcr UTSW 10 75166085 missense probably damaging 0.99
R5458:Bcr UTSW 10 75154960 missense probably benign
R5982:Bcr UTSW 10 75176416 missense probably benign 0.08
R5988:Bcr UTSW 10 75175335 missense probably benign 0.01
R6827:Bcr UTSW 10 75131064 missense probably damaging 1.00
R6886:Bcr UTSW 10 75153937 missense probably damaging 1.00
R6990:Bcr UTSW 10 75131036 missense possibly damaging 0.80
R7003:Bcr UTSW 10 75061561 missense probably benign 0.08
R7424:Bcr UTSW 10 75157100 missense probably benign
R7443:Bcr UTSW 10 75143136 critical splice donor site probably null
R7488:Bcr UTSW 10 75160330 missense possibly damaging 0.80
R8232:Bcr UTSW 10 75166051 missense probably damaging 1.00
R8360:Bcr UTSW 10 75145439 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCAGCGAGGAGGACTTTTC -3'
(R):5'- CTTGCTCTAGATCTAGACCCAAGAG -3'

Sequencing Primer
(F):5'- CCGCATGTTCCGGGACAAG -3'
(R):5'- TCTAGATCTAGACCCAAGAGAGCAC -3'
Posted On2018-02-27