Incidental Mutation 'R6220:Isl1'
ID503971
Institutional Source Beutler Lab
Gene Symbol Isl1
Ensembl Gene ENSMUSG00000042258
Gene NameISL1 transcription factor, LIM/homeodomain
SynonymsIslet 1
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location116298281-116309689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116303267 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 182 (T182A)
Ref Sequence ENSEMBL: ENSMUSP00000135567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036060] [ENSMUST00000176044]
Predicted Effect probably benign
Transcript: ENSMUST00000036060
AA Change: T182A

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000044879
Gene: ENSMUSG00000042258
AA Change: T182A

DomainStartEndE-ValueType
LIM 16 70 1.39e-13 SMART
LIM 78 132 4.99e-15 SMART
HOX 181 243 1.83e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176044
AA Change: T182A

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135567
Gene: ENSMUSG00000042258
AA Change: T182A

DomainStartEndE-ValueType
LIM 16 70 1.39e-13 SMART
LIM 78 132 4.99e-15 SMART
HOX 181 243 1.83e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176812
SMART Domains Protein: ENSMUSP00000135793
Gene: ENSMUSG00000042258

DomainStartEndE-ValueType
LIM 1 40 1.3e-5 SMART
HOX 89 151 9.4e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177469
Meta Mutation Damage Score 0.2315 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to develop motor neurons and die by embryonic day 11.5 with abnormal heart and pancreas development. Mice heterozygous for an ENU mutation exhibit chronic otitis media and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Isl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Isl1 APN 13 116303053 missense probably benign 0.02
IGL03251:Isl1 APN 13 116305449 missense probably benign
R1897:Isl1 UTSW 13 116303330 missense probably benign 0.12
R1928:Isl1 UTSW 13 116308417 missense probably damaging 1.00
R2940:Isl1 UTSW 13 116308299 missense possibly damaging 0.53
R4062:Isl1 UTSW 13 116303090 missense probably benign 0.27
R4795:Isl1 UTSW 13 116305430 missense probably benign 0.41
R4796:Isl1 UTSW 13 116305430 missense probably benign 0.41
R4836:Isl1 UTSW 13 116303083 missense probably benign 0.06
R4839:Isl1 UTSW 13 116301684 missense probably damaging 1.00
R4870:Isl1 UTSW 13 116308270 splice site probably benign
R5231:Isl1 UTSW 13 116301657 missense probably benign 0.17
R7231:Isl1 UTSW 13 116303290 missense probably benign 0.06
R8191:Isl1 UTSW 13 116305418 missense probably benign
R8493:Isl1 UTSW 13 116305299 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCTGCTTCATCATGATGCTG -3'
(R):5'- GAGCGAGAGATCTTCTTCCTCC -3'

Sequencing Primer
(F):5'- CATCATGATGCTGCGTTTCTTG -3'
(R):5'- GCGAGAGATCTTCTTCCTCCTCATC -3'
Posted On2018-02-27