Mutagenetix > Incidental Mutations

Incidental Mutation 'R6220:Olfr730'

503972

Institutional Source

Beutler Lab

Gene Symbol

Olfr730

Ensembl Gene

ENSMUSG00000109835

Gene Name

olfactory receptor 730

Synonyms

GA_x6K02T2PMLR-5881670-5880717, MOR247-1

MMRRC Submission

044352-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R6220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

50183296-50188198 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 50186678 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 180 (D180Y)

Ref Sequence

ENSEMBL: ENSMUSP00000145742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051453] [ENSMUST00000205837]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051453
AA Change: D181Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000060325
Gene: ENSMUSG00000109835
AA Change: D181Y

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	305	3.4e-44	PFAM
Pfam:7tm_1	42	288	1.2e-17	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000205837
AA Change: D180Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215779

Meta Mutation Damage Score

0.4507

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,846,115	E618G	possibly damaging	Het
Abhd16b	A	G	2: 181,493,785	D160G	probably damaging	Het
Acap1	A	G	11: 69,889,679	F15S	probably damaging	Het
Adam30	A	T	3: 98,161,309	S153C	probably damaging	Het
Afp	A	T	5: 90,504,410	D420V	possibly damaging	Het
Ak9	T	A	10: 41,370,099	H729Q	unknown	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bcr	A	G	10: 75,062,292	T423A	probably benign	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ctns	T	C	11: 73,193,128	T23A	probably benign	Het
Ddx54	T	A	5: 120,620,689	N332K	probably benign	Het
Dysf	T	A	6: 84,149,745	I1344N	probably damaging	Het
Elovl3	A	T	19: 46,134,500	M172L	probably benign	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Filip1l	T	A	16: 57,569,989	N313K	probably benign	Het
Foxp2	C	A	6: 15,437,948	T716K	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10645	A	G	8: 83,165,757		probably benign	Het
Gm10735	T	C	13: 113,041,496		probably benign	Het
Gm4847	A	T	1: 166,634,972	D316E	probably damaging	Het
Gorasp2	T	C	2: 70,690,790	L388P	probably damaging	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Herc1	A	G	9: 66,433,788	Y1729C	probably damaging	Het
Ifi207	A	T	1: 173,729,546	L542H	probably damaging	Het
Ighv3-5	T	A	12: 114,262,718	N96I	probably damaging	Het
Isl1	T	C	13: 116,303,267	T182A	probably benign	Het
Jph4	T	C	14: 55,110,085	E421G	probably benign	Het
Lrrc45	T	C	11: 120,719,527	I488T	probably benign	Het
Mroh8	A	G	2: 157,233,163	I471T	probably benign	Het
Ms4a2	A	T	19: 11,617,563	D96E	probably damaging	Het
Mst1r	T	A	9: 107,907,348	N68K	probably benign	Het
Myo18b	A	G	5: 112,757,507	M2075T	possibly damaging	Het
Neb	T	C	2: 52,270,972	K2229R	probably null	Het
Nkx6-3	T	A	8: 23,153,971		probably null	Het
Nlrp1a	C	A	11: 71,142,338	S10I	probably benign	Het
Npas2	A	T	1: 39,336,061	T487S	probably benign	Het
Nrxn1	G	C	17: 91,088,476	T84R	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh18	A	G	3: 49,745,251	C921R	probably damaging	Het
Pcdha9	A	G	18: 36,998,478	Y200C	probably damaging	Het
Pknox1	A	T	17: 31,603,203	R315*	probably null	Het
Rasgrp1	C	T	2: 117,284,929	W726*	probably null	Het
Rassf8	G	A	6: 145,817,133	R402H	probably damaging	Het
Rev3l	T	A	10: 39,822,779	Y1091N	probably damaging	Het
Riok3	T	G	18: 12,149,551	V349G	probably damaging	Het
Rps18	A	T	17: 33,955,136	V15E	probably damaging	Het
Rptor	A	T	11: 119,897,442	Y1323F	possibly damaging	Het
Rspry1	T	C	8: 94,658,750	C437R	probably damaging	Het
Sema5a	T	A	15: 32,686,729	Y996N	probably damaging	Het
Smarcad1	A	G	6: 65,114,329	I1011M	probably benign	Het
Supv3l1	A	T	10: 62,439,021	M295K	possibly damaging	Het
Sv2c	T	C	13: 95,976,626	D605G	probably damaging	Het
Teddm1b	G	A	1: 153,875,201	W252*	probably null	Het
Tes	T	A	6: 17,086,196	C29*	probably null	Het
Thsd4	A	G	9: 59,982,747	W856R	probably damaging	Het
Treml4	A	T	17: 48,264,848	D93V	possibly damaging	Het
Trim66	T	C	7: 109,483,093	T218A	probably damaging	Het
Tssk5	T	C	15: 76,373,773	D128G	probably damaging	Het
Ubr3	T	A	2: 70,020,475	W1746R	probably damaging	Het
Vmn2r11	T	C	5: 109,053,568	I357V	probably benign	Het
Vmn2r87	A	T	10: 130,479,938	D86E	probably benign	Het
Zfp184	T	G	13: 21,960,207	H694Q	probably damaging	Het
Zranb3	A	C	1: 127,999,404	F341L	probably benign	Het

Other mutations in Olfr730

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01998:Olfr730	APN	14	50186648	missense	probably benign	0.36
IGL02976:Olfr730	APN	14	50186432	nonsense	probably null
IGL03065:Olfr730	APN	14	50187008	missense	probably damaging	1.00
IGL03122:Olfr730	APN	14	50187004	missense	probably damaging	0.98
R0277:Olfr730	UTSW	14	50186332	missense	probably null	0.06
R1081:Olfr730	UTSW	14	50187197	missense	probably damaging	1.00
R1189:Olfr730	UTSW	14	50187082	missense	probably damaging	0.99
R1501:Olfr730	UTSW	14	50187082	missense	probably damaging	0.99
R2680:Olfr730	UTSW	14	50186847	nonsense	probably null
R2869:Olfr730	UTSW	14	50186354	missense	probably benign	0.08
R2869:Olfr730	UTSW	14	50186354	missense	probably benign	0.08
R3415:Olfr730	UTSW	14	50186612	missense	possibly damaging	0.60
R3417:Olfr730	UTSW	14	50186612	missense	possibly damaging	0.60
R3721:Olfr730	UTSW	14	50186680	missense	probably damaging	1.00
R4864:Olfr730	UTSW	14	50186582	missense	probably damaging	0.97
R5037:Olfr730	UTSW	14	50186288	missense	probably benign	0.00
R5349:Olfr730	UTSW	14	50186773	nonsense	probably null
R5738:Olfr730	UTSW	14	50186648	missense	probably benign	0.09
R5779:Olfr730	UTSW	14	50186746	missense	possibly damaging	0.82
R5853:Olfr730	UTSW	14	50186869	missense	possibly damaging	0.88
R5918:Olfr730	UTSW	14	50186968	missense	probably benign
R6166:Olfr730	UTSW	14	50186768	missense	probably benign
R6196:Olfr730	UTSW	14	50186678	missense	probably damaging	1.00
R6218:Olfr730	UTSW	14	50186678	missense	probably damaging	1.00
R6561:Olfr730	UTSW	14	50186318	missense	probably damaging	1.00
R6798:Olfr730	UTSW	14	50187127	missense	probably benign	0.00
R6834:Olfr730	UTSW	14	50186483	missense	probably benign	0.12
R7174:Olfr730	UTSW	14	50186696	missense	probably benign	0.00
R7406:Olfr730	UTSW	14	50186558	missense	probably damaging	0.97
R7592:Olfr730	UTSW	14	50186563	missense	probably damaging	1.00
R7886:Olfr730	UTSW	14	50186564	missense	probably damaging	1.00
R8081:Olfr730	UTSW	14	50186368	missense	probably damaging	1.00
R8280:Olfr730	UTSW	14	50186266	nonsense	probably null
R8393:Olfr730	UTSW	14	50186885	nonsense	probably null
X0023:Olfr730	UTSW	14	50187201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTGAAAGAGCCTTAGATGATCC -3'
(R):5'- CCACCTGTTCACTGGTACTGAG -3'

Sequencing Primer
(F):5'- AGAGCCTTAGATGATCCTTTGGAAG -3'
(R):5'- TCTTTTGACAGGTATATTGCAATTTG -3'

Posted On

2018-02-27