Incidental Mutation 'R6220:Sema5a'
ID503974
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
SynonymssemF, 9130201M22Rik, Semaf, M-Sema D
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location32244810-32696341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32686729 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 996 (Y996N)
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
Predicted Effect probably damaging
Transcript: ENSMUST00000067458
AA Change: Y996N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: Y996N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227429
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32618880 missense probably benign 0.06
IGL01148:Sema5a APN 15 32681495 missense probably benign 0.00
IGL01285:Sema5a APN 15 32574997 missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32417441 missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32474368 splice site probably benign
IGL01970:Sema5a APN 15 32686646 missense probably benign 0.02
IGL01986:Sema5a APN 15 32682360 splice site probably benign
IGL02053:Sema5a APN 15 32550267 missense probably benign 0.00
IGL02234:Sema5a APN 15 32679172 missense probably damaging 1.00
IGL02325:Sema5a APN 15 32686831 missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32682299 splice site probably benign
IGL02427:Sema5a APN 15 32673544 splice site probably benign
IGL02621:Sema5a APN 15 32538656 splice site probably benign
IGL02656:Sema5a APN 15 32631285 missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32538734 splice site probably benign
IGL03107:Sema5a APN 15 32669408 missense probably damaging 0.98
IGL03114:Sema5a APN 15 32673427 missense probably damaging 0.99
IGL03222:Sema5a APN 15 32628158 missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32628199 missense probably benign
R0190:Sema5a UTSW 15 32562774 missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32681609 missense probably damaging 1.00
R0413:Sema5a UTSW 15 32669444 missense probably damaging 1.00
R0504:Sema5a UTSW 15 32574803 splice site probably benign
R1235:Sema5a UTSW 15 32609226 missense probably benign 0.04
R1484:Sema5a UTSW 15 32460285 missense probably damaging 1.00
R1550:Sema5a UTSW 15 32618849 missense probably benign 0.00
R1557:Sema5a UTSW 15 32460272 missense probably benign 0.04
R1670:Sema5a UTSW 15 32548799 missense probably damaging 1.00
R1688:Sema5a UTSW 15 32669424 missense probably benign 0.01
R1760:Sema5a UTSW 15 32641106 missense probably damaging 0.99
R1960:Sema5a UTSW 15 32562731 missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32681619 missense probably damaging 0.99
R2062:Sema5a UTSW 15 32609217 splice site probably benign
R2082:Sema5a UTSW 15 32618856 missense probably benign 0.04
R2218:Sema5a UTSW 15 32631309 missense probably damaging 0.99
R2267:Sema5a UTSW 15 32574919 missense probably benign 0.03
R2299:Sema5a UTSW 15 32562776 missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32550253 missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32673400 missense probably damaging 1.00
R3950:Sema5a UTSW 15 32689338 missense probably damaging 1.00
R4197:Sema5a UTSW 15 32618918 missense probably benign
R4496:Sema5a UTSW 15 32640987 missense probably damaging 1.00
R4840:Sema5a UTSW 15 32550254 missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32609417 missense probably benign
R4867:Sema5a UTSW 15 32550290 missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32679164 missense probably damaging 1.00
R4977:Sema5a UTSW 15 32679186 missense probably damaging 1.00
R5204:Sema5a UTSW 15 32686647 missense probably benign 0.00
R5580:Sema5a UTSW 15 32574885 missense probably benign 0.00
R5937:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R6897:Sema5a UTSW 15 32550275 missense probably benign 0.05
R7037:Sema5a UTSW 15 32686847 missense probably damaging 1.00
R7072:Sema5a UTSW 15 32574959 missense possibly damaging 0.94
R7273:Sema5a UTSW 15 32417462 missense probably benign
R7572:Sema5a UTSW 15 32673428 missense probably damaging 1.00
R7621:Sema5a UTSW 15 32609232 missense possibly damaging 0.65
R7642:Sema5a UTSW 15 32682325 missense probably damaging 0.97
R7870:Sema5a UTSW 15 32609339 missense probably benign 0.23
R7880:Sema5a UTSW 15 32686808 missense probably damaging 1.00
R8025:Sema5a UTSW 15 32548782 missense probably benign 0.37
R8034:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R8241:Sema5a UTSW 15 32574918 missense probably benign
R8539:Sema5a UTSW 15 32618843 missense probably damaging 0.98
X0020:Sema5a UTSW 15 32417500 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTAGACCCTGACATTCCCAAG -3'
(R):5'- AGTGTCACCTGCCTTTGTGG -3'

Sequencing Primer
(F):5'- GACATCTATACCTTGGGATACGCAG -3'
(R):5'- TGTGGCCTCCCTAGCTG -3'
Posted On2018-02-27