Mutagenetix > Incidental Mutations

Incidental Mutation 'R6220:Sema5a'

503974

Institutional Source

Beutler Lab

Gene Symbol

Sema5a

Ensembl Gene

ENSMUSG00000022231

Gene Name

sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A

Synonyms

semF, 9130201M22Rik, Semaf, M-Sema D

MMRRC Submission

044352-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32244810-32696341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32686729 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 996 (Y996N)

Ref Sequence

ENSEMBL: ENSMUSP00000069024 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067458]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067458
AA Change: Y996N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: Y996N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Sema	58	468	2.18e-173	SMART
PSI	486	533	1.78e-9	SMART
TSP1	543	597	2.23e-1	SMART
TSP1	598	651	2.05e-15	SMART
TSP1	656	702	6.94e-13	SMART
low complexity region	707	715	N/A	INTRINSIC
low complexity region	755	771	N/A	INTRINSIC
TSP1	787	839	4.17e-16	SMART
TSP1	844	896	9.08e-17	SMART
TSP1	899	946	3.19e-3	SMART
low complexity region	949	960	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227429

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,846,115	E618G	possibly damaging	Het
Abhd16b	A	G	2: 181,493,785	D160G	probably damaging	Het
Acap1	A	G	11: 69,889,679	F15S	probably damaging	Het
Adam30	A	T	3: 98,161,309	S153C	probably damaging	Het
Afp	A	T	5: 90,504,410	D420V	possibly damaging	Het
Ak9	T	A	10: 41,370,099	H729Q	unknown	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bcr	A	G	10: 75,062,292	T423A	probably benign	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ctns	T	C	11: 73,193,128	T23A	probably benign	Het
Ddx54	T	A	5: 120,620,689	N332K	probably benign	Het
Dysf	T	A	6: 84,149,745	I1344N	probably damaging	Het
Elovl3	A	T	19: 46,134,500	M172L	probably benign	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Filip1l	T	A	16: 57,569,989	N313K	probably benign	Het
Foxp2	C	A	6: 15,437,948	T716K	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10645	A	G	8: 83,165,757		probably benign	Het
Gm10735	T	C	13: 113,041,496		probably benign	Het
Gm4847	A	T	1: 166,634,972	D316E	probably damaging	Het
Gorasp2	T	C	2: 70,690,790	L388P	probably damaging	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Herc1	A	G	9: 66,433,788	Y1729C	probably damaging	Het
Ifi207	A	T	1: 173,729,546	L542H	probably damaging	Het
Ighv3-5	T	A	12: 114,262,718	N96I	probably damaging	Het
Isl1	T	C	13: 116,303,267	T182A	probably benign	Het
Jph4	T	C	14: 55,110,085	E421G	probably benign	Het
Lrrc45	T	C	11: 120,719,527	I488T	probably benign	Het
Mroh8	A	G	2: 157,233,163	I471T	probably benign	Het
Ms4a2	A	T	19: 11,617,563	D96E	probably damaging	Het
Mst1r	T	A	9: 107,907,348	N68K	probably benign	Het
Myo18b	A	G	5: 112,757,507	M2075T	possibly damaging	Het
Neb	T	C	2: 52,270,972	K2229R	probably null	Het
Nkx6-3	T	A	8: 23,153,971		probably null	Het
Nlrp1a	C	A	11: 71,142,338	S10I	probably benign	Het
Npas2	A	T	1: 39,336,061	T487S	probably benign	Het
Nrxn1	G	C	17: 91,088,476	T84R	probably benign	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh18	A	G	3: 49,745,251	C921R	probably damaging	Het
Pcdha9	A	G	18: 36,998,478	Y200C	probably damaging	Het
Pknox1	A	T	17: 31,603,203	R315*	probably null	Het
Rasgrp1	C	T	2: 117,284,929	W726*	probably null	Het
Rassf8	G	A	6: 145,817,133	R402H	probably damaging	Het
Rev3l	T	A	10: 39,822,779	Y1091N	probably damaging	Het
Riok3	T	G	18: 12,149,551	V349G	probably damaging	Het
Rps18	A	T	17: 33,955,136	V15E	probably damaging	Het
Rptor	A	T	11: 119,897,442	Y1323F	possibly damaging	Het
Rspry1	T	C	8: 94,658,750	C437R	probably damaging	Het
Smarcad1	A	G	6: 65,114,329	I1011M	probably benign	Het
Supv3l1	A	T	10: 62,439,021	M295K	possibly damaging	Het
Sv2c	T	C	13: 95,976,626	D605G	probably damaging	Het
Teddm1b	G	A	1: 153,875,201	W252*	probably null	Het
Tes	T	A	6: 17,086,196	C29*	probably null	Het
Thsd4	A	G	9: 59,982,747	W856R	probably damaging	Het
Treml4	A	T	17: 48,264,848	D93V	possibly damaging	Het
Trim66	T	C	7: 109,483,093	T218A	probably damaging	Het
Tssk5	T	C	15: 76,373,773	D128G	probably damaging	Het
Ubr3	T	A	2: 70,020,475	W1746R	probably damaging	Het
Vmn2r11	T	C	5: 109,053,568	I357V	probably benign	Het
Vmn2r87	A	T	10: 130,479,938	D86E	probably benign	Het
Zfp184	T	G	13: 21,960,207	H694Q	probably damaging	Het
Zranb3	A	C	1: 127,999,404	F341L	probably benign	Het

Other mutations in Sema5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Sema5a	APN	15	32618880	missense	probably benign	0.06
IGL01148:Sema5a	APN	15	32681495	missense	probably benign	0.00
IGL01285:Sema5a	APN	15	32574997	missense	possibly damaging	0.66
IGL01647:Sema5a	APN	15	32417441	missense	possibly damaging	0.82
IGL01845:Sema5a	APN	15	32474368	splice site	probably benign
IGL01970:Sema5a	APN	15	32686646	missense	probably benign	0.02
IGL01986:Sema5a	APN	15	32682360	splice site	probably benign
IGL02053:Sema5a	APN	15	32550267	missense	probably benign	0.00
IGL02234:Sema5a	APN	15	32679172	missense	probably damaging	1.00
IGL02325:Sema5a	APN	15	32686831	missense	possibly damaging	0.63
IGL02370:Sema5a	APN	15	32682299	splice site	probably benign
IGL02427:Sema5a	APN	15	32673544	splice site	probably benign
IGL02621:Sema5a	APN	15	32538656	splice site	probably benign
IGL02656:Sema5a	APN	15	32631285	missense	possibly damaging	0.95
IGL03091:Sema5a	APN	15	32538734	splice site	probably benign
IGL03107:Sema5a	APN	15	32669408	missense	probably damaging	0.98
IGL03114:Sema5a	APN	15	32673427	missense	probably damaging	0.99
IGL03222:Sema5a	APN	15	32628158	missense	probably benign	0.32
PIT4305001:Sema5a	UTSW	15	32628199	missense	probably benign
R0190:Sema5a	UTSW	15	32562774	missense	possibly damaging	0.93
R0409:Sema5a	UTSW	15	32681609	missense	probably damaging	1.00
R0413:Sema5a	UTSW	15	32669444	missense	probably damaging	1.00
R0504:Sema5a	UTSW	15	32574803	splice site	probably benign
R1235:Sema5a	UTSW	15	32609226	missense	probably benign	0.04
R1484:Sema5a	UTSW	15	32460285	missense	probably damaging	1.00
R1550:Sema5a	UTSW	15	32618849	missense	probably benign	0.00
R1557:Sema5a	UTSW	15	32460272	missense	probably benign	0.04
R1670:Sema5a	UTSW	15	32548799	missense	probably damaging	1.00
R1688:Sema5a	UTSW	15	32669424	missense	probably benign	0.01
R1760:Sema5a	UTSW	15	32641106	missense	probably damaging	0.99
R1960:Sema5a	UTSW	15	32562731	missense	possibly damaging	0.66
R1967:Sema5a	UTSW	15	32681619	missense	probably damaging	0.99
R2062:Sema5a	UTSW	15	32609217	splice site	probably benign
R2082:Sema5a	UTSW	15	32618856	missense	probably benign	0.04
R2218:Sema5a	UTSW	15	32631309	missense	probably damaging	0.99
R2267:Sema5a	UTSW	15	32574919	missense	probably benign	0.03
R2299:Sema5a	UTSW	15	32562776	missense	possibly damaging	0.95
R2438:Sema5a	UTSW	15	32550253	missense	possibly damaging	0.63
R2698:Sema5a	UTSW	15	32673400	missense	probably damaging	1.00
R3950:Sema5a	UTSW	15	32689338	missense	probably damaging	1.00
R4197:Sema5a	UTSW	15	32618918	missense	probably benign
R4496:Sema5a	UTSW	15	32640987	missense	probably damaging	1.00
R4840:Sema5a	UTSW	15	32550254	missense	possibly damaging	0.63
R4842:Sema5a	UTSW	15	32609417	missense	probably benign
R4867:Sema5a	UTSW	15	32550290	missense	possibly damaging	0.60
R4934:Sema5a	UTSW	15	32679164	missense	probably damaging	1.00
R4977:Sema5a	UTSW	15	32679186	missense	probably damaging	1.00
R5204:Sema5a	UTSW	15	32686647	missense	probably benign	0.00
R5580:Sema5a	UTSW	15	32574885	missense	probably benign	0.00
R5937:Sema5a	UTSW	15	32574841	missense	probably damaging	1.00
R6897:Sema5a	UTSW	15	32550275	missense	probably benign	0.05
R7037:Sema5a	UTSW	15	32686847	missense	probably damaging	1.00
R7072:Sema5a	UTSW	15	32574959	missense	possibly damaging	0.94
R7273:Sema5a	UTSW	15	32417462	missense	probably benign
R7572:Sema5a	UTSW	15	32673428	missense	probably damaging	1.00
R7621:Sema5a	UTSW	15	32609232	missense	possibly damaging	0.65
R7642:Sema5a	UTSW	15	32682325	missense	probably damaging	0.97
R7870:Sema5a	UTSW	15	32609339	missense	probably benign	0.23
R7880:Sema5a	UTSW	15	32686808	missense	probably damaging	1.00
R8025:Sema5a	UTSW	15	32548782	missense	probably benign	0.37
R8034:Sema5a	UTSW	15	32574841	missense	probably damaging	1.00
R8241:Sema5a	UTSW	15	32574918	missense	probably benign
R8539:Sema5a	UTSW	15	32618843	missense	probably damaging	0.98
X0020:Sema5a	UTSW	15	32417500	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTCTAGACCCTGACATTCCCAAG -3'
(R):5'- AGTGTCACCTGCCTTTGTGG -3'

Sequencing Primer
(F):5'- GACATCTATACCTTGGGATACGCAG -3'
(R):5'- TGTGGCCTCCCTAGCTG -3'

Posted On

2018-02-27