Incidental Mutation 'R6220:Filip1l'
ID 503976
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Name filamin A interacting protein 1-like
Synonyms
MMRRC Submission 044352-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6220 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 57353093-57573126 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 57569989 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 313 (N313K)
Ref Sequence ENSEMBL: ENSMUSP00000124179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159414
AA Change: N75K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: N75K

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159816
AA Change: N313K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: N313K

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231282
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Meta Mutation Damage Score 0.0977 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 splice site probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
R7578:Filip1l UTSW 16 57513282 missense probably damaging 0.99
R7691:Filip1l UTSW 16 57572433 missense probably benign 0.00
R7950:Filip1l UTSW 16 57569711 missense probably damaging 1.00
R8288:Filip1l UTSW 16 57570554 missense probably damaging 1.00
R8334:Filip1l UTSW 16 57570147 missense probably benign 0.18
R8392:Filip1l UTSW 16 57571353 missense probably damaging 1.00
R8742:Filip1l UTSW 16 57571230 missense probably damaging 1.00
R9020:Filip1l UTSW 16 57570695 missense probably benign 0.00
R9157:Filip1l UTSW 16 57571617 missense probably benign 0.04
RF019:Filip1l UTSW 16 57570641 missense probably benign 0.07
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGGTGGTGGATGAACAAC -3'
(R):5'- CCACTTCATCCATGATGCCAG -3'

Sequencing Primer
(F):5'- GGCTTACAGCTCAACTCGC -3'
(R):5'- ATCCATGATGCCAGAGTTTCC -3'
Posted On 2018-02-27