Incidental Mutation 'R6220:Pknox1'
ID503977
Institutional Source Beutler Lab
Gene Symbol Pknox1
Ensembl Gene ENSMUSG00000006705
Gene NamePbx/knotted 1 homeobox
SynonymsD17Wsu76e, PREP1
MMRRC Submission 044352-MU
Accession Numbers

Genbank: NM_016670; MGI: 1201409

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6220 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location31564749-31607684 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 31603203 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 315 (R315*)
Ref Sequence ENSEMBL: ENSMUSP00000135804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097352] [ENSMUST00000175806] [ENSMUST00000176701]
Predicted Effect probably null
Transcript: ENSMUST00000097352
AA Change: R315*
SMART Domains Protein: ENSMUSP00000094966
Gene: ENSMUSG00000006705
AA Change: R315*

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 80 165 1.7e-39 PFAM
low complexity region 208 227 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
HOX 259 324 9.8e-12 SMART
low complexity region 404 415 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175806
AA Change: R315*
SMART Domains Protein: ENSMUSP00000134852
Gene: ENSMUSG00000006705
AA Change: R315*

DomainStartEndE-ValueType
low complexity region 208 227 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
HOX 259 324 9.8e-12 SMART
low complexity region 404 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176513
Predicted Effect probably null
Transcript: ENSMUST00000176701
AA Change: R315*
SMART Domains Protein: ENSMUSP00000135804
Gene: ENSMUSG00000006705
AA Change: R315*

DomainStartEndE-ValueType
low complexity region 208 227 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
HOX 259 324 9.8e-12 SMART
low complexity region 404 415 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development with variable penetrance, decreased body weight, and impaired T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(80) : Targeted, knock-out(1) Gene trapped(79)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Mst1r T A 9: 107,907,348 N68K probably benign Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Pknox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Pknox1 APN 17 31599645 critical splice donor site probably null
IGL01830:Pknox1 APN 17 31595310 missense probably benign 0.21
IGL02070:Pknox1 APN 17 31603365 splice site probably benign
IGL02309:Pknox1 APN 17 31590709 missense probably benign 0.34
IGL02707:Pknox1 APN 17 31602819 missense possibly damaging 0.84
3-1:Pknox1 UTSW 17 31588462 missense probably benign 0.02
R0001:Pknox1 UTSW 17 31599636 missense probably damaging 0.98
R0147:Pknox1 UTSW 17 31604790 missense probably benign 0.01
R0148:Pknox1 UTSW 17 31604790 missense probably benign 0.01
R0388:Pknox1 UTSW 17 31603192 missense probably damaging 1.00
R0443:Pknox1 UTSW 17 31592219 missense probably damaging 1.00
R0920:Pknox1 UTSW 17 31596891 missense probably damaging 0.99
R1428:Pknox1 UTSW 17 31592092 splice site probably benign
R1563:Pknox1 UTSW 17 31595282 missense probably damaging 1.00
R4199:Pknox1 UTSW 17 31602816 missense probably damaging 0.96
R4200:Pknox1 UTSW 17 31599610 missense probably benign 0.04
R4665:Pknox1 UTSW 17 31595326 critical splice donor site probably null
R4700:Pknox1 UTSW 17 31603312 missense probably damaging 1.00
R4764:Pknox1 UTSW 17 31590713 missense possibly damaging 0.92
R5127:Pknox1 UTSW 17 31590739 missense probably benign 0.00
R6712:Pknox1 UTSW 17 31595316 missense probably benign 0.23
R6865:Pknox1 UTSW 17 31588560 missense probably damaging 0.98
R7186:Pknox1 UTSW 17 31603198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGCCACCTTACTCAACTAAATTC -3'
(R):5'- AGTTGACAGCAGCTGACCTG -3'

Sequencing Primer
(F):5'- AAAGATCTGGCCCTGCTT -3'
(R):5'- CCTTGGACCACCTGAAGTG -3'
Posted On2018-02-27