Incidental Mutation 'R6221:Tank'
ID503995
Institutional Source Beutler Lab
Gene Symbol Tank
Ensembl Gene ENSMUSG00000064289
Gene NameTRAF family member-associated Nf-kappa B activator
SynonymsE430026L09Rik, I-TRAF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R6221 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location61578585-61654171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61650083 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 321 (E321G)
Ref Sequence ENSEMBL: ENSMUSP00000108121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078074] [ENSMUST00000112494] [ENSMUST00000112495] [ENSMUST00000112501] [ENSMUST00000112502]
Predicted Effect probably damaging
Transcript: ENSMUST00000078074
AA Change: E322G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077219
Gene: ENSMUSG00000064289
AA Change: E322G

DomainStartEndE-ValueType
coiled coil region 60 98 N/A INTRINSIC
Pfam:TBD 165 219 1.2e-27 PFAM
ZnF_C2H2 417 443 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112494
AA Change: E287G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108113
Gene: ENSMUSG00000064289
AA Change: E287G

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 5.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112495
AA Change: E287G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108114
Gene: ENSMUSG00000064289
AA Change: E287G

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 1.3e-33 PFAM
ZnF_C2H2 382 408 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112501
AA Change: E288G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108120
Gene: ENSMUSG00000064289
AA Change: E288G

DomainStartEndE-ValueType
coiled coil region 26 64 N/A INTRINSIC
Pfam:TBD 129 185 1.3e-33 PFAM
ZnF_C2H2 383 409 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112502
AA Change: E321G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108121
Gene: ENSMUSG00000064289
AA Change: E321G

DomainStartEndE-ValueType
coiled coil region 56 97 N/A INTRINSIC
Pfam:TBD 162 218 8.2e-34 PFAM
ZnF_C2H2 416 442 1.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154693
Meta Mutation Damage Score 0.2783 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice develop fatal glomerulonephritis owing to deposition of immune complexes. Dendritic cells, macrophages and B cells from these mice are hyper-responsive to stimuli leading to increased production of immunoglobulins and inflammatory cytokines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,175,450 M108V probably benign Het
Adgrl1 C T 8: 83,937,687 Q1236* probably null Het
Adprhl1 T C 8: 13,225,634 I375V probably benign Het
Akap2 C T 4: 57,855,618 Q559* probably null Het
B020031M17Rik T G 13: 119,949,998 H24P probably damaging Het
Bsn A G 9: 108,105,566 S3663P unknown Het
Ccdc114 T C 7: 45,947,479 L410P probably damaging Het
Cfap44 A T 16: 44,437,186 Q1028L probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Col1a2 T C 6: 4,539,490 S1253P unknown Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Dmxl1 A G 18: 49,871,732 Y949C probably damaging Het
E130311K13Rik T C 3: 63,915,731 Y164C probably benign Het
Evx1 T A 6: 52,316,783 V312E probably damaging Het
Fam240b T C 13: 64,481,777 N75S probably benign Het
Fat2 A G 11: 55,296,072 probably null Het
Fbn1 G T 2: 125,320,921 D2148E probably benign Het
Fzd4 A G 7: 89,404,892 H69R probably damaging Het
Fzd6 T C 15: 39,030,844 V135A probably benign Het
Gimap8 T C 6: 48,658,942 L547S probably damaging Het
Gm12394 A T 4: 42,793,153 N326K probably benign Het
Gnrhr G A 5: 86,185,403 Q203* probably null Het
Gpaa1 T G 15: 76,333,832 V341G probably benign Het
Grik3 T A 4: 125,705,123 L828Q probably damaging Het
Heatr5b T C 17: 78,766,954 N1568S probably benign Het
Hpf1 T A 8: 60,893,774 V41E probably damaging Het
Hsd3b1 A T 3: 98,853,156 M173K probably benign Het
Hsd3b6 A G 3: 98,806,533 I150T probably benign Het
Ica1 C G 6: 8,644,181 L369F possibly damaging Het
Inf2 T G 12: 112,603,745 S293A possibly damaging Het
Klra10 T C 6: 130,269,272 T247A probably benign Het
Kpna1 G A 16: 36,020,688 G91D probably benign Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Ltb4r2 C T 14: 55,762,083 R54W probably damaging Het
Mki67 A G 7: 135,697,914 F1797S probably benign Het
Mlh3 C A 12: 85,268,418 Q331H possibly damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1489 T A 19: 13,633,466 Y118* probably null Het
Oxct2b T C 4: 123,116,808 Y174H probably damaging Het
Pclo G A 5: 14,675,313 R1395Q unknown Het
Ppara A G 15: 85,777,680 I41V probably benign Het
Ppip5k2 A T 1: 97,730,028 I766K probably damaging Het
Ppm1j A G 3: 104,785,776 N483S possibly damaging Het
Prex2 T C 1: 11,266,012 I1478T probably benign Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rsl1d1 A G 16: 11,201,311 V121A probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Slc15a1 T C 14: 121,464,904 Q610R probably null Het
Slc1a6 A G 10: 78,800,076 E325G probably damaging Het
Slc7a13 A G 4: 19,839,305 I303V probably benign Het
Smc3 T A 19: 53,641,931 V1123E probably damaging Het
Smco1 G A 16: 32,273,205 V34I probably benign Het
Spag1 A G 15: 36,197,803 R304G probably benign Het
Spta1 A G 1: 174,181,776 D293G probably damaging Het
Sspo C A 6: 48,463,705 P1751Q probably damaging Het
Syt14 A T 1: 192,930,600 Y631N probably damaging Het
Taar3 A G 10: 23,950,072 N172S possibly damaging Het
Thbs1 C A 2: 118,119,997 L704M probably damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Togaram1 A T 12: 64,966,546 E190D probably damaging Het
Traf1 A C 2: 34,948,301 V175G probably benign Het
Trib3 A T 2: 152,338,608 C222S probably damaging Het
Tsen34 T A 7: 3,695,544 I229N probably damaging Het
Ttc28 A G 5: 111,271,248 D1370G probably benign Het
Ugt1a5 G A 1: 88,166,242 R64H probably benign Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vdac3 A G 8: 22,588,743 V17A possibly damaging Het
Yif1b C T 7: 29,245,782 T220I possibly damaging Het
Zfp846 T G 9: 20,593,295 H150Q possibly damaging Het
Zwilch A T 9: 64,161,383 H181Q probably damaging Het
Other mutations in Tank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02994:Tank APN 2 61650292 splice site probably benign
malade UTSW 2 61644424 critical splice donor site probably null
R1620:Tank UTSW 2 61650098 missense possibly damaging 0.92
R1671:Tank UTSW 2 61649753 missense probably damaging 0.99
R1862:Tank UTSW 2 61649912 missense probably damaging 1.00
R3918:Tank UTSW 2 61643786 critical splice donor site probably null
R4714:Tank UTSW 2 61650229 missense probably benign 0.01
R4727:Tank UTSW 2 61653532 missense probably benign 0.05
R4865:Tank UTSW 2 61578635 start gained probably benign
R4867:Tank UTSW 2 61578635 start gained probably benign
R5023:Tank UTSW 2 61578635 start gained probably benign
R5213:Tank UTSW 2 61649948 missense probably benign 0.01
R5562:Tank UTSW 2 61650208 missense possibly damaging 0.59
R5950:Tank UTSW 2 61653569 utr 3 prime probably benign
R6626:Tank UTSW 2 61650296 splice site probably benign
R6670:Tank UTSW 2 61644424 critical splice donor site probably null
R6850:Tank UTSW 2 61650002 missense probably benign 0.19
R7027:Tank UTSW 2 61653422 missense probably benign 0.00
R7478:Tank UTSW 2 61650169 missense probably damaging 1.00
R8293:Tank UTSW 2 61644414 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ATAGAGGTATGTCGTGCGTCAC -3'
(R):5'- ACAGCCTTTCCTGGGGAATC -3'

Sequencing Primer
(F):5'- CTGTCACACCAAGAGGACTGG -3'
(R):5'- TCCAGTGAGGGAAAAGGTGC -3'
Posted On2018-02-28