Incidental Mutation 'R6221:Gimap8'
ID504018
Institutional Source Beutler Lab
Gene Symbol Gimap8
Ensembl Gene ENSMUSG00000064262
Gene NameGTPase, IMAP family member 8
SynonymsIAN9, LOC243374
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6221 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48647234-48660875 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48658942 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 547 (L547S)
Ref Sequence ENSEMBL: ENSMUSP00000145255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078223] [ENSMUST00000203083] [ENSMUST00000203509]
Predicted Effect probably benign
Transcript: ENSMUST00000078223
SMART Domains Protein: ENSMUSP00000077350
Gene: ENSMUSG00000064262

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203083
AA Change: L547S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145286
Gene: ENSMUSG00000064262
AA Change: L547S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203509
AA Change: L547S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145255
Gene: ENSMUSG00000064262
AA Change: L547S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:AIG1 49 251 1.5e-55 PFAM
Pfam:MMR_HSR1 50 173 4.7e-7 PFAM
Pfam:AIG1 285 473 7.7e-51 PFAM
Pfam:AIG1 476 682 4.2e-67 PFAM
Pfam:MMR_HSR1 477 603 3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. The encoded protein is larger than the other gene family members and includes three AIG1 domains (corresponding to the AIG1 protein from Arabidopsis thaliana) whereas other family members have one AIG1 domain. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,175,450 M108V probably benign Het
Adgrl1 C T 8: 83,937,687 Q1236* probably null Het
Adprhl1 T C 8: 13,225,634 I375V probably benign Het
Akap2 C T 4: 57,855,618 Q559* probably null Het
B020031M17Rik T G 13: 119,949,998 H24P probably damaging Het
Bsn A G 9: 108,105,566 S3663P unknown Het
Ccdc114 T C 7: 45,947,479 L410P probably damaging Het
Cfap44 A T 16: 44,437,186 Q1028L probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Col1a2 T C 6: 4,539,490 S1253P unknown Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Dmxl1 A G 18: 49,871,732 Y949C probably damaging Het
E130311K13Rik T C 3: 63,915,731 Y164C probably benign Het
Evx1 T A 6: 52,316,783 V312E probably damaging Het
Fam240b T C 13: 64,481,777 N75S probably benign Het
Fat2 A G 11: 55,296,072 probably null Het
Fbn1 G T 2: 125,320,921 D2148E probably benign Het
Fzd4 A G 7: 89,404,892 H69R probably damaging Het
Fzd6 T C 15: 39,030,844 V135A probably benign Het
Gm12394 A T 4: 42,793,153 N326K probably benign Het
Gnrhr G A 5: 86,185,403 Q203* probably null Het
Gpaa1 T G 15: 76,333,832 V341G probably benign Het
Grik3 T A 4: 125,705,123 L828Q probably damaging Het
Heatr5b T C 17: 78,766,954 N1568S probably benign Het
Hpf1 T A 8: 60,893,774 V41E probably damaging Het
Hsd3b1 A T 3: 98,853,156 M173K probably benign Het
Hsd3b6 A G 3: 98,806,533 I150T probably benign Het
Ica1 C G 6: 8,644,181 L369F possibly damaging Het
Inf2 T G 12: 112,603,745 S293A possibly damaging Het
Klra10 T C 6: 130,269,272 T247A probably benign Het
Kpna1 G A 16: 36,020,688 G91D probably benign Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Ltb4r2 C T 14: 55,762,083 R54W probably damaging Het
Mki67 A G 7: 135,697,914 F1797S probably benign Het
Mlh3 C A 12: 85,268,418 Q331H possibly damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1489 T A 19: 13,633,466 Y118* probably null Het
Oxct2b T C 4: 123,116,808 Y174H probably damaging Het
Pclo G A 5: 14,675,313 R1395Q unknown Het
Ppara A G 15: 85,777,680 I41V probably benign Het
Ppip5k2 A T 1: 97,730,028 I766K probably damaging Het
Ppm1j A G 3: 104,785,776 N483S possibly damaging Het
Prex2 T C 1: 11,266,012 I1478T probably benign Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rsl1d1 A G 16: 11,201,311 V121A probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Slc15a1 T C 14: 121,464,904 Q610R probably null Het
Slc1a6 A G 10: 78,800,076 E325G probably damaging Het
Slc7a13 A G 4: 19,839,305 I303V probably benign Het
Smc3 T A 19: 53,641,931 V1123E probably damaging Het
Smco1 G A 16: 32,273,205 V34I probably benign Het
Spag1 A G 15: 36,197,803 R304G probably benign Het
Spta1 A G 1: 174,181,776 D293G probably damaging Het
Sspo C A 6: 48,463,705 P1751Q probably damaging Het
Syt14 A T 1: 192,930,600 Y631N probably damaging Het
Taar3 A G 10: 23,950,072 N172S possibly damaging Het
Tank A G 2: 61,650,083 E321G probably damaging Het
Thbs1 C A 2: 118,119,997 L704M probably damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Togaram1 A T 12: 64,966,546 E190D probably damaging Het
Traf1 A C 2: 34,948,301 V175G probably benign Het
Trib3 A T 2: 152,338,608 C222S probably damaging Het
Tsen34 T A 7: 3,695,544 I229N probably damaging Het
Ttc28 A G 5: 111,271,248 D1370G probably benign Het
Ugt1a5 G A 1: 88,166,242 R64H probably benign Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vdac3 A G 8: 22,588,743 V17A possibly damaging Het
Yif1b C T 7: 29,245,782 T220I possibly damaging Het
Zfp846 T G 9: 20,593,295 H150Q possibly damaging Het
Zwilch A T 9: 64,161,383 H181Q probably damaging Het
Other mutations in Gimap8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Gimap8 APN 6 48658767 missense probably damaging 1.00
IGL02830:Gimap8 APN 6 48656305 missense probably benign 0.01
Kangchenjunga UTSW 6 48659163 missense probably damaging 1.00
lhotse UTSW 6 48658954 missense possibly damaging 0.74
R1224:Gimap8 UTSW 6 48650695 missense probably benign 0.04
R1386:Gimap8 UTSW 6 48656653 missense probably benign 0.04
R1503:Gimap8 UTSW 6 48647529 critical splice donor site probably null
R1560:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R1681:Gimap8 UTSW 6 48656411 missense probably benign 0.01
R2012:Gimap8 UTSW 6 48656353 missense probably damaging 0.98
R2094:Gimap8 UTSW 6 48650568 missense probably benign 0.00
R2937:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R2938:Gimap8 UTSW 6 48658796 missense possibly damaging 0.55
R3147:Gimap8 UTSW 6 48650506 missense probably damaging 1.00
R4276:Gimap8 UTSW 6 48659083 missense probably benign 0.35
R4281:Gimap8 UTSW 6 48658820 missense probably benign 0.37
R4294:Gimap8 UTSW 6 48658957 missense probably benign 0.00
R4713:Gimap8 UTSW 6 48658986 missense probably benign 0.23
R4750:Gimap8 UTSW 6 48650427 missense probably benign 0.01
R4896:Gimap8 UTSW 6 48659347 missense possibly damaging 0.85
R4936:Gimap8 UTSW 6 48656134 missense probably damaging 1.00
R5041:Gimap8 UTSW 6 48659163 missense probably damaging 1.00
R5091:Gimap8 UTSW 6 48656647 missense possibly damaging 0.91
R5215:Gimap8 UTSW 6 48651083 missense possibly damaging 0.88
R5360:Gimap8 UTSW 6 48656302 missense probably damaging 1.00
R6119:Gimap8 UTSW 6 48658954 missense possibly damaging 0.74
R6450:Gimap8 UTSW 6 48656451 missense probably benign 0.03
R7137:Gimap8 UTSW 6 48650253 missense probably damaging 0.99
R7154:Gimap8 UTSW 6 48656188 missense probably damaging 1.00
R7666:Gimap8 UTSW 6 48659155 missense probably damaging 1.00
R7686:Gimap8 UTSW 6 48656072 missense probably damaging 0.99
R7912:Gimap8 UTSW 6 48651065 missense probably benign 0.09
R7993:Gimap8 UTSW 6 48651065 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACGTGAAACGATGAACATGC -3'
(R):5'- TCCTTCCGTGTAAACAGCAC -3'

Sequencing Primer
(F):5'- GTGAAACGATGAACATGCATCATC -3'
(R):5'- CAAAACTGGCCTCCAGTT -3'
Posted On2018-02-28