Incidental Mutation 'R6221:Abcc8'
ID504024
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R6221 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46175450 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 108 (M108V)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123] [ENSMUST00000210511]
Predicted Effect probably benign
Transcript: ENSMUST00000033123
AA Change: M108V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: M108V

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210986
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl1 C T 8: 83,937,687 Q1236* probably null Het
Adprhl1 T C 8: 13,225,634 I375V probably benign Het
Akap2 C T 4: 57,855,618 Q559* probably null Het
B020031M17Rik T G 13: 119,949,998 H24P probably damaging Het
Bsn A G 9: 108,105,566 S3663P unknown Het
Ccdc114 T C 7: 45,947,479 L410P probably damaging Het
Cfap44 A T 16: 44,437,186 Q1028L probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Col1a2 T C 6: 4,539,490 S1253P unknown Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Dmxl1 A G 18: 49,871,732 Y949C probably damaging Het
E130311K13Rik T C 3: 63,915,731 Y164C probably benign Het
Evx1 T A 6: 52,316,783 V312E probably damaging Het
Fam240b T C 13: 64,481,777 N75S probably benign Het
Fat2 A G 11: 55,296,072 probably null Het
Fbn1 G T 2: 125,320,921 D2148E probably benign Het
Fzd4 A G 7: 89,404,892 H69R probably damaging Het
Fzd6 T C 15: 39,030,844 V135A probably benign Het
Gimap8 T C 6: 48,658,942 L547S probably damaging Het
Gm12394 A T 4: 42,793,153 N326K probably benign Het
Gnrhr G A 5: 86,185,403 Q203* probably null Het
Gpaa1 T G 15: 76,333,832 V341G probably benign Het
Grik3 T A 4: 125,705,123 L828Q probably damaging Het
Heatr5b T C 17: 78,766,954 N1568S probably benign Het
Hpf1 T A 8: 60,893,774 V41E probably damaging Het
Hsd3b1 A T 3: 98,853,156 M173K probably benign Het
Hsd3b6 A G 3: 98,806,533 I150T probably benign Het
Ica1 C G 6: 8,644,181 L369F possibly damaging Het
Inf2 T G 12: 112,603,745 S293A possibly damaging Het
Klra10 T C 6: 130,269,272 T247A probably benign Het
Kpna1 G A 16: 36,020,688 G91D probably benign Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Ltb4r2 C T 14: 55,762,083 R54W probably damaging Het
Mki67 A G 7: 135,697,914 F1797S probably benign Het
Mlh3 C A 12: 85,268,418 Q331H possibly damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1489 T A 19: 13,633,466 Y118* probably null Het
Oxct2b T C 4: 123,116,808 Y174H probably damaging Het
Pclo G A 5: 14,675,313 R1395Q unknown Het
Ppara A G 15: 85,777,680 I41V probably benign Het
Ppip5k2 A T 1: 97,730,028 I766K probably damaging Het
Ppm1j A G 3: 104,785,776 N483S possibly damaging Het
Prex2 T C 1: 11,266,012 I1478T probably benign Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rsl1d1 A G 16: 11,201,311 V121A probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Slc15a1 T C 14: 121,464,904 Q610R probably null Het
Slc1a6 A G 10: 78,800,076 E325G probably damaging Het
Slc7a13 A G 4: 19,839,305 I303V probably benign Het
Smc3 T A 19: 53,641,931 V1123E probably damaging Het
Smco1 G A 16: 32,273,205 V34I probably benign Het
Spag1 A G 15: 36,197,803 R304G probably benign Het
Spta1 A G 1: 174,181,776 D293G probably damaging Het
Sspo C A 6: 48,463,705 P1751Q probably damaging Het
Syt14 A T 1: 192,930,600 Y631N probably damaging Het
Taar3 A G 10: 23,950,072 N172S possibly damaging Het
Tank A G 2: 61,650,083 E321G probably damaging Het
Thbs1 C A 2: 118,119,997 L704M probably damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Togaram1 A T 12: 64,966,546 E190D probably damaging Het
Traf1 A C 2: 34,948,301 V175G probably benign Het
Trib3 A T 2: 152,338,608 C222S probably damaging Het
Tsen34 T A 7: 3,695,544 I229N probably damaging Het
Ttc28 A G 5: 111,271,248 D1370G probably benign Het
Ugt1a5 G A 1: 88,166,242 R64H probably benign Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vdac3 A G 8: 22,588,743 V17A possibly damaging Het
Yif1b C T 7: 29,245,782 T220I possibly damaging Het
Zfp846 T G 9: 20,593,295 H150Q possibly damaging Het
Zwilch A T 9: 64,161,383 H181Q probably damaging Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767 splice site probably benign
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3840:Abcc8 UTSW 7 46108100 missense possibly damaging 0.67
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
R7046:Abcc8 UTSW 7 46122940 missense probably damaging 1.00
R7230:Abcc8 UTSW 7 46117388 missense probably benign
R7287:Abcc8 UTSW 7 46113110 missense probably damaging 1.00
R7292:Abcc8 UTSW 7 46135526 missense probably benign
R7299:Abcc8 UTSW 7 46105498 missense possibly damaging 0.62
R7411:Abcc8 UTSW 7 46165917 critical splice donor site probably null
R7693:Abcc8 UTSW 7 46178544 missense probably damaging 0.99
R7704:Abcc8 UTSW 7 46106644 missense probably damaging 0.98
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTCTGCACAGATAACCAC -3'
(R):5'- GCCTATGAAGGGATGCCATG -3'

Sequencing Primer
(F):5'- ACAGAGGCAGAGACCTTCTC -3'
(R):5'- TGGTTACCCAAGACACTACTGTGTG -3'
Posted On2018-02-28