Incidental Mutation 'R6221:Slc15a1'
ID504047
Institutional Source Beutler Lab
Gene Symbol Slc15a1
Ensembl Gene ENSMUSG00000025557
Gene Namesolute carrier family 15 (oligopeptide transporter), member 1
SynonymsPECT1, PEPT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6221 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location121459621-121505252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121464904 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 610 (Q610R)
Ref Sequence ENSEMBL: ENSMUSP00000085728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088386]
Predicted Effect probably null
Transcript: ENSMUST00000088386
AA Change: Q610R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: Q610R

DomainStartEndE-ValueType
Pfam:PTR2 81 477 1.9e-141 PFAM
Pfam:PTR2 562 644 4.2e-11 PFAM
transmembrane domain 650 672 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 T C 7: 46,175,450 M108V probably benign Het
Adgrl1 C T 8: 83,937,687 Q1236* probably null Het
Adprhl1 T C 8: 13,225,634 I375V probably benign Het
Akap2 C T 4: 57,855,618 Q559* probably null Het
B020031M17Rik T G 13: 119,949,998 H24P probably damaging Het
Bsn A G 9: 108,105,566 S3663P unknown Het
Ccdc114 T C 7: 45,947,479 L410P probably damaging Het
Cfap44 A T 16: 44,437,186 Q1028L probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Col1a2 T C 6: 4,539,490 S1253P unknown Het
Dkk3 A G 7: 112,121,646 Y158H probably damaging Het
Dmxl1 A G 18: 49,871,732 Y949C probably damaging Het
E130311K13Rik T C 3: 63,915,731 Y164C probably benign Het
Evx1 T A 6: 52,316,783 V312E probably damaging Het
Fam240b T C 13: 64,481,777 N75S probably benign Het
Fat2 A G 11: 55,296,072 probably null Het
Fbn1 G T 2: 125,320,921 D2148E probably benign Het
Fzd4 A G 7: 89,404,892 H69R probably damaging Het
Fzd6 T C 15: 39,030,844 V135A probably benign Het
Gimap8 T C 6: 48,658,942 L547S probably damaging Het
Gm12394 A T 4: 42,793,153 N326K probably benign Het
Gnrhr G A 5: 86,185,403 Q203* probably null Het
Gpaa1 T G 15: 76,333,832 V341G probably benign Het
Grik3 T A 4: 125,705,123 L828Q probably damaging Het
Heatr5b T C 17: 78,766,954 N1568S probably benign Het
Hpf1 T A 8: 60,893,774 V41E probably damaging Het
Hsd3b1 A T 3: 98,853,156 M173K probably benign Het
Hsd3b6 A G 3: 98,806,533 I150T probably benign Het
Ica1 C G 6: 8,644,181 L369F possibly damaging Het
Inf2 T G 12: 112,603,745 S293A possibly damaging Het
Klra10 T C 6: 130,269,272 T247A probably benign Het
Kpna1 G A 16: 36,020,688 G91D probably benign Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Ltb4r2 C T 14: 55,762,083 R54W probably damaging Het
Mki67 A G 7: 135,697,914 F1797S probably benign Het
Mlh3 C A 12: 85,268,418 Q331H possibly damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1489 T A 19: 13,633,466 Y118* probably null Het
Oxct2b T C 4: 123,116,808 Y174H probably damaging Het
Pclo G A 5: 14,675,313 R1395Q unknown Het
Ppara A G 15: 85,777,680 I41V probably benign Het
Ppip5k2 A T 1: 97,730,028 I766K probably damaging Het
Ppm1j A G 3: 104,785,776 N483S possibly damaging Het
Prex2 T C 1: 11,266,012 I1478T probably benign Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rsl1d1 A G 16: 11,201,311 V121A probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Slc1a6 A G 10: 78,800,076 E325G probably damaging Het
Slc7a13 A G 4: 19,839,305 I303V probably benign Het
Smc3 T A 19: 53,641,931 V1123E probably damaging Het
Smco1 G A 16: 32,273,205 V34I probably benign Het
Spag1 A G 15: 36,197,803 R304G probably benign Het
Spta1 A G 1: 174,181,776 D293G probably damaging Het
Sspo C A 6: 48,463,705 P1751Q probably damaging Het
Syt14 A T 1: 192,930,600 Y631N probably damaging Het
Taar3 A G 10: 23,950,072 N172S possibly damaging Het
Tank A G 2: 61,650,083 E321G probably damaging Het
Thbs1 C A 2: 118,119,997 L704M probably damaging Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Togaram1 A T 12: 64,966,546 E190D probably damaging Het
Traf1 A C 2: 34,948,301 V175G probably benign Het
Trib3 A T 2: 152,338,608 C222S probably damaging Het
Tsen34 T A 7: 3,695,544 I229N probably damaging Het
Ttc28 A G 5: 111,271,248 D1370G probably benign Het
Ugt1a5 G A 1: 88,166,242 R64H probably benign Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vdac3 A G 8: 22,588,743 V17A possibly damaging Het
Yif1b C T 7: 29,245,782 T220I possibly damaging Het
Zfp846 T G 9: 20,593,295 H150Q possibly damaging Het
Zwilch A T 9: 64,161,383 H181Q probably damaging Het
Other mutations in Slc15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Slc15a1 APN 14 121460679 missense possibly damaging 0.95
IGL01534:Slc15a1 APN 14 121464952 missense possibly damaging 0.95
IGL01783:Slc15a1 APN 14 121471276 critical splice donor site probably null
IGL01799:Slc15a1 APN 14 121480729 missense possibly damaging 0.76
IGL02064:Slc15a1 APN 14 121462499 missense possibly damaging 0.66
IGL02064:Slc15a1 APN 14 121462474 missense probably benign 0.20
IGL02115:Slc15a1 APN 14 121480661 missense possibly damaging 0.61
IGL02514:Slc15a1 APN 14 121487040 missense probably damaging 1.00
IGL03056:Slc15a1 APN 14 121491283 missense possibly damaging 0.82
IGL03297:Slc15a1 APN 14 121486684 missense probably damaging 1.00
R1484:Slc15a1 UTSW 14 121491239 nonsense probably null
R1532:Slc15a1 UTSW 14 121475984 missense possibly damaging 0.79
R1655:Slc15a1 UTSW 14 121465899 missense probably benign 0.34
R2013:Slc15a1 UTSW 14 121475987 missense possibly damaging 0.88
R2270:Slc15a1 UTSW 14 121479994 missense probably damaging 0.99
R2878:Slc15a1 UTSW 14 121465933 missense probably benign 0.00
R2986:Slc15a1 UTSW 14 121489809 missense probably benign 0.02
R3862:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3863:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3978:Slc15a1 UTSW 14 121489827 missense probably benign 0.00
R4184:Slc15a1 UTSW 14 121466162 missense probably benign 0.00
R4573:Slc15a1 UTSW 14 121487029 missense probably damaging 0.99
R4604:Slc15a1 UTSW 14 121489907 missense probably damaging 1.00
R4649:Slc15a1 UTSW 14 121478092 missense probably damaging 1.00
R5838:Slc15a1 UTSW 14 121484871 missense probably damaging 1.00
R6891:Slc15a1 UTSW 14 121476030 missense probably benign 0.00
R7626:Slc15a1 UTSW 14 121475965 missense probably benign 0.13
R7836:Slc15a1 UTSW 14 121480733 nonsense probably null
R7919:Slc15a1 UTSW 14 121480733 nonsense probably null
Z1088:Slc15a1 UTSW 14 121480054 missense probably benign 0.09
Z1088:Slc15a1 UTSW 14 121491044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATGATGCTTAGAAGAAGAAGAA -3'
(R):5'- AAAGTGTATCTCTGCGTCTCTC -3'

Sequencing Primer
(F):5'- CATAAGTGGTGGTGCATGCCTAC -3'
(R):5'- GTCTCTCTCGACGGCCTG -3'
Posted On2018-02-28