Mutagenetix > Incidental Mutation

Incidental Mutation 'R6221:Slc15a1'

504047

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R6221 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121464904 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 610 (Q610R)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably null
Transcript: ENSMUST00000088386
AA Change: Q610R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: Q610R

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	T	C	7: 46,175,450	M108V	probably benign	Het
Adgrl1	C	T	8: 83,937,687	Q1236*	probably null	Het
Adprhl1	T	C	8: 13,225,634	I375V	probably benign	Het
Akap2	C	T	4: 57,855,618	Q559*	probably null	Het
B020031M17Rik	T	G	13: 119,949,998	H24P	probably damaging	Het
Bsn	A	G	9: 108,105,566	S3663P	unknown	Het
Ccdc114	T	C	7: 45,947,479	L410P	probably damaging	Het
Cfap44	A	T	16: 44,437,186	Q1028L	probably benign	Het
Cftr	A	C	6: 18,282,501	T1067P	probably benign	Het
Col1a2	T	C	6: 4,539,490	S1253P	unknown	Het
Dkk3	A	G	7: 112,121,646	Y158H	probably damaging	Het
Dmxl1	A	G	18: 49,871,732	Y949C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,731	Y164C	probably benign	Het
Evx1	T	A	6: 52,316,783	V312E	probably damaging	Het
Fam240b	T	C	13: 64,481,777	N75S	probably benign	Het
Fat2	A	G	11: 55,296,072		probably null	Het
Fbn1	G	T	2: 125,320,921	D2148E	probably benign	Het
Fzd4	A	G	7: 89,404,892	H69R	probably damaging	Het
Fzd6	T	C	15: 39,030,844	V135A	probably benign	Het
Gimap8	T	C	6: 48,658,942	L547S	probably damaging	Het
Gm12394	A	T	4: 42,793,153	N326K	probably benign	Het
Gnrhr	G	A	5: 86,185,403	Q203*	probably null	Het
Gpaa1	T	G	15: 76,333,832	V341G	probably benign	Het
Grik3	T	A	4: 125,705,123	L828Q	probably damaging	Het
Heatr5b	T	C	17: 78,766,954	N1568S	probably benign	Het
Hpf1	T	A	8: 60,893,774	V41E	probably damaging	Het
Hsd3b1	A	T	3: 98,853,156	M173K	probably benign	Het
Hsd3b6	A	G	3: 98,806,533	I150T	probably benign	Het
Ica1	C	G	6: 8,644,181	L369F	possibly damaging	Het
Inf2	T	G	12: 112,603,745	S293A	possibly damaging	Het
Klra10	T	C	6: 130,269,272	T247A	probably benign	Het
Kpna1	G	A	16: 36,020,688	G91D	probably benign	Het
Ldlrap1	C	T	4: 134,757,360	E108K	probably damaging	Het
Ltb4r2	C	T	14: 55,762,083	R54W	probably damaging	Het
Mki67	A	G	7: 135,697,914	F1797S	probably benign	Het
Mlh3	C	A	12: 85,268,418	Q331H	possibly damaging	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfr1489	T	A	19: 13,633,466	Y118*	probably null	Het
Oxct2b	T	C	4: 123,116,808	Y174H	probably damaging	Het
Pclo	G	A	5: 14,675,313	R1395Q	unknown	Het
Ppara	A	G	15: 85,777,680	I41V	probably benign	Het
Ppip5k2	A	T	1: 97,730,028	I766K	probably damaging	Het
Ppm1j	A	G	3: 104,785,776	N483S	possibly damaging	Het
Prex2	T	C	1: 11,266,012	I1478T	probably benign	Het
Ror2	T	C	13: 53,113,217	Y394C	probably damaging	Het
Rsl1d1	A	G	16: 11,201,311	V121A	probably damaging	Het
Sart3	C	T	5: 113,743,206	A938T	probably benign	Het
Slc1a6	A	G	10: 78,800,076	E325G	probably damaging	Het
Slc7a13	A	G	4: 19,839,305	I303V	probably benign	Het
Smc3	T	A	19: 53,641,931	V1123E	probably damaging	Het
Smco1	G	A	16: 32,273,205	V34I	probably benign	Het
Spag1	A	G	15: 36,197,803	R304G	probably benign	Het
Spta1	A	G	1: 174,181,776	D293G	probably damaging	Het
Sspo	C	A	6: 48,463,705	P1751Q	probably damaging	Het
Syt14	A	T	1: 192,930,600	Y631N	probably damaging	Het
Taar3	A	G	10: 23,950,072	N172S	possibly damaging	Het
Tank	A	G	2: 61,650,083	E321G	probably damaging	Het
Thbs1	C	A	2: 118,119,997	L704M	probably damaging	Het
Tmem116	C	T	5: 121,491,108	T188M	probably benign	Het
Togaram1	A	T	12: 64,966,546	E190D	probably damaging	Het
Traf1	A	C	2: 34,948,301	V175G	probably benign	Het
Trib3	A	T	2: 152,338,608	C222S	probably damaging	Het
Tsen34	T	A	7: 3,695,544	I229N	probably damaging	Het
Ttc28	A	G	5: 111,271,248	D1370G	probably benign	Het
Ugt1a5	G	A	1: 88,166,242	R64H	probably benign	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vdac3	A	G	8: 22,588,743	V17A	possibly damaging	Het
Yif1b	C	T	7: 29,245,782	T220I	possibly damaging	Het
Zfp846	T	G	9: 20,593,295	H150Q	possibly damaging	Het
Zwilch	A	T	9: 64,161,383	H181Q	probably damaging	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCATGATGCTTAGAAGAAGAAGAA -3'
(R):5'- AAAGTGTATCTCTGCGTCTCTC -3'

Sequencing Primer
(F):5'- CATAAGTGGTGGTGCATGCCTAC -3'
(R):5'- GTCTCTCTCGACGGCCTG -3'

Posted On

2018-02-28