Incidental Mutation 'R6222:Als2'
ID504059
Institutional Source Beutler Lab
Gene Symbol Als2
Ensembl Gene ENSMUSG00000026024
Gene Namealsin Rho guanine nucleotide exchange factor
Synonyms3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location59162926-59237231 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59180125 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1222 (D1222G)
Ref Sequence ENSEMBL: ENSMUSP00000125753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027178] [ENSMUST00000163058]
Predicted Effect probably benign
Transcript: ENSMUST00000027178
AA Change: D1222G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027178
Gene: ENSMUSG00000026024
AA Change: D1222G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 1.1e-9 PFAM
Pfam:RCC1 109 165 9.5e-11 PFAM
Pfam:RCC1 170 216 6.6e-11 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 5.4e-13 PFAM
Pfam:RCC1_2 555 584 8.3e-12 PFAM
Pfam:RCC1 571 619 3.4e-11 PFAM
Pfam:RhoGEF 688 877 6.5e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 8.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163058
AA Change: D1222G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000125753
Gene: ENSMUSG00000026024
AA Change: D1222G

DomainStartEndE-ValueType
Pfam:RCC1_2 93 122 9.9e-10 PFAM
Pfam:RCC1 109 165 9.5e-12 PFAM
Pfam:RCC1 170 216 4.9e-12 PFAM
low complexity region 268 282 N/A INTRINSIC
low complexity region 465 483 N/A INTRINSIC
Pfam:RCC1 521 568 4.6e-14 PFAM
Pfam:RCC1_2 555 584 1.2e-11 PFAM
Pfam:RCC1 571 619 8.6e-11 PFAM
Pfam:RhoGEF 688 877 2.6e-10 PFAM
PH 895 1001 2.17e0 SMART
MORN 1041 1062 1.34e-5 SMART
MORN 1064 1085 1.95e-1 SMART
MORN 1092 1113 6.68e-6 SMART
MORN 1115 1136 9.39e0 SMART
MORN 1143 1164 1.49e1 SMART
MORN 1167 1188 1.13e1 SMART
MORN 1190 1211 2.28e0 SMART
MORN 1213 1235 5.95e1 SMART
low complexity region 1470 1483 N/A INTRINSIC
Pfam:VPS9 1546 1650 1e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATS1/RCC1-like domain, a RhoGEF domain, and a vacuolar protein sorting 9 (VPS9) domain, all of which are guanine-nucleotide exchange factors that activate members of the Ras superfamily of GTPases. The protein functions as a guanine nucleotide exchange factor for the small GTPase RAB5. The protein localizes with RAB5 on early endosomal compartments, and functions as a modulator for endosomal dynamics. Mutations in this gene result in several forms of juvenile lateral sclerosis and infantile-onset ascending spastic paralysis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mutations in this gene may result in increased body weight, altered endosome trafficking, modest motor behavioral abnormalities, altered anxiety responses, impaired axonal transport, and mild neurolopathogical deficits including axonal degeneration in the corticospinal tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Als2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Als2 APN 1 59169896 nonsense probably null
IGL00924:Als2 APN 1 59215862 missense probably benign 0.03
IGL00949:Als2 APN 1 59215572 missense probably damaging 1.00
IGL00950:Als2 APN 1 59215382 missense probably benign 0.01
IGL01090:Als2 APN 1 59215616 missense possibly damaging 0.81
IGL01116:Als2 APN 1 59186004 splice site probably benign
IGL02001:Als2 APN 1 59180188 splice site probably benign
IGL02075:Als2 APN 1 59207786 missense probably damaging 1.00
IGL02441:Als2 APN 1 59215472 missense probably damaging 0.98
IGL02728:Als2 APN 1 59196347 missense probably benign 0.00
IGL02740:Als2 APN 1 59169919 missense probably benign 0.01
IGL02885:Als2 APN 1 59167491 missense probably benign 0.30
IGL02896:Als2 APN 1 59183787 missense probably benign 0.17
IGL02978:Als2 APN 1 59215165 missense probably benign 0.32
IGL03032:Als2 APN 1 59216030 splice site probably benign
IGL03065:Als2 APN 1 59215872 missense probably benign
IGL03212:Als2 APN 1 59202926 missense probably benign 0.00
IGL03226:Als2 APN 1 59186520 missense probably benign 0.43
R0014:Als2 UTSW 1 59211388 missense possibly damaging 0.53
R0243:Als2 UTSW 1 59215387 missense probably benign
R0326:Als2 UTSW 1 59180583 missense probably damaging 1.00
R0376:Als2 UTSW 1 59215565 missense probably benign 0.00
R0605:Als2 UTSW 1 59168414 missense probably benign 0.02
R1607:Als2 UTSW 1 59180147 missense probably damaging 1.00
R1631:Als2 UTSW 1 59218067 missense probably benign 0.00
R1657:Als2 UTSW 1 59180601 missense probably damaging 1.00
R1763:Als2 UTSW 1 59174991 missense probably benign
R1950:Als2 UTSW 1 59185601 critical splice acceptor site probably null
R1970:Als2 UTSW 1 59215169 missense probably benign 0.34
R2151:Als2 UTSW 1 59207789 missense probably damaging 1.00
R2292:Als2 UTSW 1 59187385 missense probably damaging 1.00
R2513:Als2 UTSW 1 59215117 missense probably benign 0.00
R2849:Als2 UTSW 1 59206538 missense probably damaging 0.97
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2869:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2870:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2872:Als2 UTSW 1 59211137 missense probably damaging 1.00
R2873:Als2 UTSW 1 59211137 missense probably damaging 1.00
R3054:Als2 UTSW 1 59215494 missense probably damaging 1.00
R3081:Als2 UTSW 1 59187349 missense probably damaging 1.00
R3176:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3276:Als2 UTSW 1 59170008 missense possibly damaging 0.88
R3801:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3803:Als2 UTSW 1 59167199 missense probably damaging 1.00
R3808:Als2 UTSW 1 59170450 missense probably benign 0.08
R3884:Als2 UTSW 1 59185568 missense probably damaging 0.99
R4012:Als2 UTSW 1 59187416 missense probably benign 0.09
R4033:Als2 UTSW 1 59196241 missense probably benign
R4201:Als2 UTSW 1 59180154 missense possibly damaging 0.77
R4321:Als2 UTSW 1 59167454 splice site probably benign
R4707:Als2 UTSW 1 59215313 missense probably benign
R4784:Als2 UTSW 1 59215313 missense probably benign
R4785:Als2 UTSW 1 59215313 missense probably benign
R4991:Als2 UTSW 1 59207768 missense probably benign 0.10
R5068:Als2 UTSW 1 59211274 missense probably benign 0.13
R5110:Als2 UTSW 1 59185441 missense probably damaging 0.98
R5141:Als2 UTSW 1 59170452 missense possibly damaging 0.80
R5394:Als2 UTSW 1 59174946 missense probably benign 0.06
R5621:Als2 UTSW 1 59191890 missense probably benign 0.33
R5685:Als2 UTSW 1 59179091 missense possibly damaging 0.73
R5987:Als2 UTSW 1 59206587 missense probably damaging 1.00
R6012:Als2 UTSW 1 59185215 missense probably damaging 1.00
R6118:Als2 UTSW 1 59203069 missense possibly damaging 0.62
R6367:Als2 UTSW 1 59199140 missense probably benign 0.04
R6394:Als2 UTSW 1 59167197 missense probably damaging 0.99
R6866:Als2 UTSW 1 59211133 missense probably damaging 1.00
R6965:Als2 UTSW 1 59170557 missense possibly damaging 0.70
R7038:Als2 UTSW 1 59167514 missense possibly damaging 0.94
R7178:Als2 UTSW 1 59207812 missense probably damaging 0.96
R7494:Als2 UTSW 1 59183166 splice site probably null
R7541:Als2 UTSW 1 59167616 splice site probably null
R7601:Als2 UTSW 1 59170002 missense probably benign 0.17
R8380:Als2 UTSW 1 59211308 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTTGTGGCCAATTCCTTC -3'
(R):5'- GGAAATCTCCTGTGTCCCTAACC -3'

Sequencing Primer
(F):5'- GTTTGTGGCCAATTCCTTCTAAAG -3'
(R):5'- GTGAATACCTACCTGGCTTGGAAC -3'
Posted On2018-02-28