Incidental Mutation 'R6222:Ino80d'
ID504060
Institutional Source Beutler Lab
Gene Symbol Ino80d
Ensembl Gene ENSMUSG00000040865
Gene NameINO80 complex subunit D
SynonymsA430093A21Rik
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location62958418-63114667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63058525 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 737 (H737Y)
Ref Sequence ENSEMBL: ENSMUSP00000127378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097718] [ENSMUST00000133236] [ENSMUST00000137511] [ENSMUST00000153992] [ENSMUST00000165066] [ENSMUST00000172416]
Predicted Effect probably damaging
Transcript: ENSMUST00000097718
AA Change: H737Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095325
Gene: ENSMUSG00000040865
AA Change: H737Y

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133236
AA Change: H737Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123430
Gene: ENSMUSG00000040865
AA Change: H737Y

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 337 401 4.3e-20 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137511
SMART Domains Protein: ENSMUSP00000119118
Gene: ENSMUSG00000040865

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153992
SMART Domains Protein: ENSMUSP00000115332
Gene: ENSMUSG00000040865

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 431 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165066
AA Change: H842Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130864
Gene: ENSMUSG00000040865
AA Change: H842Y

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 18 79 5.9e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
low complexity region 258 263 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Pfam:zf-C3Hc3H 442 506 7e-21 PFAM
low complexity region 519 564 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
low complexity region 995 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172416
AA Change: H737Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127378
Gene: ENSMUSG00000040865
AA Change: H737Y

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188100
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Ino80d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ino80d APN 1 63093303 missense probably damaging 1.00
IGL01552:Ino80d APN 1 63057977 utr 3 prime probably benign
IGL01960:Ino80d APN 1 63058147 missense probably damaging 0.98
IGL02374:Ino80d APN 1 63086061 missense possibly damaging 0.63
IGL03201:Ino80d APN 1 63058308 missense probably damaging 1.00
IGL03248:Ino80d APN 1 63068182 critical splice donor site probably null
Creepy UTSW 1 63079047 missense possibly damaging 0.88
Friable UTSW 1 63062126 missense probably damaging 1.00
Herpes UTSW 1 63065834 missense probably damaging 1.00
PIT4696001:Ino80d UTSW 1 63085986 missense probably benign
R0153:Ino80d UTSW 1 63058318 missense probably damaging 0.97
R0371:Ino80d UTSW 1 63057956 utr 3 prime probably benign
R0416:Ino80d UTSW 1 63086276 missense possibly damaging 0.93
R1738:Ino80d UTSW 1 63093465 missense probably damaging 1.00
R2341:Ino80d UTSW 1 63065826 missense possibly damaging 0.75
R2351:Ino80d UTSW 1 63085835 missense probably benign 0.00
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R3814:Ino80d UTSW 1 63074424 missense probably benign 0.05
R3828:Ino80d UTSW 1 63062078 missense possibly damaging 0.94
R3947:Ino80d UTSW 1 63074503 missense probably benign 0.16
R3949:Ino80d UTSW 1 63074503 missense probably benign 0.16
R5180:Ino80d UTSW 1 63086329 start gained probably benign
R5301:Ino80d UTSW 1 63074419 missense probably benign
R5338:Ino80d UTSW 1 63058939 missense probably benign 0.34
R5634:Ino80d UTSW 1 63062283 intron probably benign
R5716:Ino80d UTSW 1 63058697 missense probably benign 0.01
R5841:Ino80d UTSW 1 63058840 missense probably damaging 1.00
R6219:Ino80d UTSW 1 63079047 missense possibly damaging 0.88
R6283:Ino80d UTSW 1 63062126 missense probably damaging 1.00
R6720:Ino80d UTSW 1 63058610 missense probably damaging 1.00
R6835:Ino80d UTSW 1 63074326 missense probably benign
R6897:Ino80d UTSW 1 63065834 missense probably damaging 1.00
R7162:Ino80d UTSW 1 63065735 missense probably damaging 1.00
R7403:Ino80d UTSW 1 63062219 missense possibly damaging 0.52
R7644:Ino80d UTSW 1 63058771 missense probably benign 0.18
R7816:Ino80d UTSW 1 63086397 missense probably damaging 1.00
R8054:Ino80d UTSW 1 63058678 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGGAAAGAAGGTGTCCGTCC -3'
(R):5'- CAGGACAGTTTCATGGCCTTC -3'

Sequencing Primer
(F):5'- CGCCAAGGAGGTTGCTAAATGC -3'
(R):5'- CCTTCATGATGGCAGCCATG -3'
Posted On2018-02-28