Incidental Mutation 'R6222:Styxl2'
ID 504063
Institutional Source Beutler Lab
Gene Symbol Styxl2
Ensembl Gene ENSMUSG00000026564
Gene Name serine/threonine/tyrosine interacting like 2
Synonyms C130085G02Rik, Dusp27
MMRRC Submission 044353-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6222 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 165925717-165955467 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 165926214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 1133 (Q1133K)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
AlphaFold Q148W8
Predicted Effect probably benign
Transcript: ENSMUST00000085992
AA Change: Q1133K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: Q1133K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192369
AA Change: Q1133K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: Q1133K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,531,923 (GRCm39) *217W probably null Het
Abcc3 A G 11: 94,259,431 (GRCm39) F337L probably benign Het
Abcc4 T A 14: 118,767,368 (GRCm39) H903L probably damaging Het
Akap7 T A 10: 25,159,844 (GRCm39) K119* probably null Het
Als2 T C 1: 59,219,284 (GRCm39) D1222G probably benign Het
Ano4 T C 10: 88,863,084 (GRCm39) Y296C probably damaging Het
Arid1b A G 17: 5,377,922 (GRCm39) probably null Het
Arl10 T C 13: 54,726,644 (GRCm39) F141L probably damaging Het
B130006D01Rik T C 11: 95,616,988 (GRCm39) probably benign Het
Bbs9 T A 9: 22,479,147 (GRCm39) S197T possibly damaging Het
Bicd1 A T 6: 149,414,463 (GRCm39) D392V probably damaging Het
Bmi1 T A 2: 18,688,513 (GRCm39) M168K possibly damaging Het
C7 A T 15: 5,041,423 (GRCm39) D494E possibly damaging Het
Cacna1s A T 1: 136,032,360 (GRCm39) N1221I probably benign Het
Cacng7 A G 7: 3,385,128 (GRCm39) T10A probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdpf1 T C 15: 85,691,643 (GRCm39) R108G possibly damaging Het
Ceacam5 A T 7: 17,479,472 (GRCm39) K196N probably benign Het
Cftr A C 6: 18,282,500 (GRCm39) T1067P probably benign Het
Cma2 T C 14: 56,210,649 (GRCm39) I112T possibly damaging Het
Cntnap4 A G 8: 113,569,353 (GRCm39) S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 (GRCm39) Y627* probably null Het
Fam204a A G 19: 60,188,400 (GRCm39) probably null Het
Galnt1 T A 18: 24,397,591 (GRCm39) probably null Het
Gbe1 T C 16: 70,325,900 (GRCm39) probably null Het
Gm6871 C T 7: 41,196,006 (GRCm39) D244N probably damaging Het
Gna15 T C 10: 81,347,880 (GRCm39) T189A probably damaging Het
Igsf10 C T 3: 59,226,336 (GRCm39) D2446N possibly damaging Het
Ing2 T C 8: 48,121,966 (GRCm39) K194R possibly damaging Het
Ino80d G A 1: 63,097,684 (GRCm39) H737Y probably damaging Het
Izumo4 C T 10: 80,538,885 (GRCm39) R83W probably damaging Het
Kcnt1 G A 2: 25,782,522 (GRCm39) V219M probably damaging Het
Kiz A T 2: 146,732,981 (GRCm39) S386C probably damaging Het
Ldlrap1 C T 4: 134,484,671 (GRCm39) E108K probably damaging Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Or2ad1 T C 13: 21,327,047 (GRCm39) Y60C probably damaging Het
Or4c100 T C 2: 88,329,614 (GRCm39) Y62H probably benign Het
Pdzd2 T C 15: 12,374,652 (GRCm39) K1828E probably damaging Het
Prl3a1 T C 13: 27,460,097 (GRCm39) F194L probably benign Het
Prss1l A T 6: 41,374,100 (GRCm39) Y234F probably damaging Het
Reg1 A T 6: 78,404,357 (GRCm39) Q77L probably benign Het
Ruvbl2 G T 7: 45,074,149 (GRCm39) D248E probably damaging Het
Sart3 C T 5: 113,881,267 (GRCm39) A938T probably benign Het
Serpinb5 T A 1: 106,798,070 (GRCm39) C20S probably benign Het
Sh2d4b A C 14: 40,542,694 (GRCm39) S361A probably damaging Het
Snx2 T A 18: 53,332,896 (GRCm39) L190* probably null Het
Sorcs3 A T 19: 48,748,296 (GRCm39) Y755F possibly damaging Het
Tiam2 A G 17: 3,503,613 (GRCm39) Q930R probably damaging Het
Tll1 C A 8: 64,551,568 (GRCm39) G271V probably benign Het
Tmem116 C T 5: 121,629,171 (GRCm39) T188M probably benign Het
Tmem181a T C 17: 6,351,192 (GRCm39) V367A probably benign Het
Umodl1 T C 17: 31,221,866 (GRCm39) probably null Het
Virma C T 4: 11,527,820 (GRCm39) A1187V probably damaging Het
Wdr53 T C 16: 32,075,482 (GRCm39) V229A probably benign Het
Zcchc10 T C 11: 53,223,289 (GRCm39) probably benign Het
Other mutations in Styxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Styxl2 APN 1 165,928,121 (GRCm39) missense probably benign 0.00
IGL00973:Styxl2 APN 1 165,927,027 (GRCm39) missense probably benign
IGL01331:Styxl2 APN 1 165,935,749 (GRCm39) missense probably damaging 1.00
IGL01466:Styxl2 APN 1 165,928,073 (GRCm39) missense probably damaging 1.00
IGL01572:Styxl2 APN 1 165,927,941 (GRCm39) missense probably benign 0.18
IGL01906:Styxl2 APN 1 165,927,092 (GRCm39) missense probably damaging 1.00
IGL01974:Styxl2 APN 1 165,928,105 (GRCm39) nonsense probably null
IGL02112:Styxl2 APN 1 165,927,240 (GRCm39) nonsense probably null
IGL02805:Styxl2 APN 1 165,926,630 (GRCm39) missense probably damaging 1.00
IGL03343:Styxl2 APN 1 165,927,017 (GRCm39) missense probably benign 0.00
R0116:Styxl2 UTSW 1 165,927,270 (GRCm39) missense probably benign 0.19
R0367:Styxl2 UTSW 1 165,928,332 (GRCm39) missense probably benign 0.05
R0499:Styxl2 UTSW 1 165,926,670 (GRCm39) missense probably benign 0.00
R0542:Styxl2 UTSW 1 165,928,853 (GRCm39) missense possibly damaging 0.90
R1312:Styxl2 UTSW 1 165,926,860 (GRCm39) missense possibly damaging 0.46
R1572:Styxl2 UTSW 1 165,927,024 (GRCm39) missense possibly damaging 0.68
R1598:Styxl2 UTSW 1 165,937,828 (GRCm39) missense probably benign 0.10
R1858:Styxl2 UTSW 1 165,928,415 (GRCm39) missense possibly damaging 0.87
R2021:Styxl2 UTSW 1 165,928,392 (GRCm39) missense probably benign 0.00
R2970:Styxl2 UTSW 1 165,926,798 (GRCm39) missense probably benign 0.04
R3727:Styxl2 UTSW 1 165,927,075 (GRCm39) missense probably damaging 1.00
R4041:Styxl2 UTSW 1 165,927,680 (GRCm39) missense probably benign 0.01
R4245:Styxl2 UTSW 1 165,928,685 (GRCm39) missense probably damaging 1.00
R4955:Styxl2 UTSW 1 165,935,661 (GRCm39) missense probably damaging 1.00
R4967:Styxl2 UTSW 1 165,954,675 (GRCm39) missense probably damaging 1.00
R5040:Styxl2 UTSW 1 165,927,914 (GRCm39) missense probably benign 0.17
R5342:Styxl2 UTSW 1 165,937,819 (GRCm39) missense probably benign 0.01
R5467:Styxl2 UTSW 1 165,939,599 (GRCm39) critical splice donor site probably null
R5742:Styxl2 UTSW 1 165,927,023 (GRCm39) missense probably benign 0.00
R6239:Styxl2 UTSW 1 165,926,388 (GRCm39) missense probably damaging 1.00
R6531:Styxl2 UTSW 1 165,937,615 (GRCm39) splice site probably null
R6586:Styxl2 UTSW 1 165,928,454 (GRCm39) missense possibly damaging 0.79
R6958:Styxl2 UTSW 1 165,935,565 (GRCm39) missense probably damaging 1.00
R7006:Styxl2 UTSW 1 165,926,663 (GRCm39) missense probably benign
R7111:Styxl2 UTSW 1 165,954,723 (GRCm39) missense possibly damaging 0.66
R7310:Styxl2 UTSW 1 165,926,300 (GRCm39) missense possibly damaging 0.46
R7312:Styxl2 UTSW 1 165,954,676 (GRCm39) missense probably damaging 0.99
R7378:Styxl2 UTSW 1 165,939,632 (GRCm39) nonsense probably null
R7398:Styxl2 UTSW 1 165,928,044 (GRCm39) missense probably damaging 1.00
R7442:Styxl2 UTSW 1 165,928,584 (GRCm39) missense probably benign 0.01
R7569:Styxl2 UTSW 1 165,935,604 (GRCm39) missense probably damaging 1.00
R7920:Styxl2 UTSW 1 165,927,465 (GRCm39) missense possibly damaging 0.72
R7954:Styxl2 UTSW 1 165,926,849 (GRCm39) missense probably benign 0.05
R7972:Styxl2 UTSW 1 165,926,708 (GRCm39) missense probably damaging 1.00
R8186:Styxl2 UTSW 1 165,927,648 (GRCm39) missense probably damaging 1.00
R8354:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8454:Styxl2 UTSW 1 165,935,702 (GRCm39) missense probably damaging 1.00
R8535:Styxl2 UTSW 1 165,928,730 (GRCm39) missense probably benign 0.01
R9419:Styxl2 UTSW 1 165,927,755 (GRCm39) missense probably damaging 1.00
R9493:Styxl2 UTSW 1 165,926,410 (GRCm39) missense probably damaging 1.00
R9694:Styxl2 UTSW 1 165,928,654 (GRCm39) missense probably damaging 1.00
Z1088:Styxl2 UTSW 1 165,926,852 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCATGAATGGCTCTTGTCTC -3'
(R):5'- TTCACCCAGAGCTTCATGAG -3'

Sequencing Primer
(F):5'- CCACCCTACTGTCCAGGC -3'
(R):5'- GCTTCATGAGGTCTGAAGAGG -3'
Posted On 2018-02-28