Incidental Mutation 'R6222:Dusp27'
ID504063
Institutional Source Beutler Lab
Gene Symbol Dusp27
Ensembl Gene ENSMUSG00000026564
Gene Namedual specificity phosphatase 27 (putative)
SynonymsC130085G02Rik
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location166098148-166127922 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 166098645 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1133 (Q1133K)
Ref Sequence ENSEMBL: ENSMUSP00000141564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]
Predicted Effect probably benign
Transcript: ENSMUST00000085992
AA Change: Q1133K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: Q1133K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192369
AA Change: Q1133K

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: Q1133K

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
DSPc 133 277 2.45e-30 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 404 425 N/A INTRINSIC
low complexity region 429 439 N/A INTRINSIC
low complexity region 618 635 N/A INTRINSIC
low complexity region 655 666 N/A INTRINSIC
low complexity region 773 788 N/A INTRINSIC
coiled coil region 813 839 N/A INTRINSIC
low complexity region 851 860 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1001 1019 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
low complexity region 1074 1091 N/A INTRINSIC
low complexity region 1108 1120 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Dusp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Dusp27 APN 1 166100552 missense probably benign 0.00
IGL00973:Dusp27 APN 1 166099458 missense probably benign
IGL01331:Dusp27 APN 1 166108180 missense probably damaging 1.00
IGL01466:Dusp27 APN 1 166100504 missense probably damaging 1.00
IGL01572:Dusp27 APN 1 166100372 missense probably benign 0.18
IGL01906:Dusp27 APN 1 166099523 missense probably damaging 1.00
IGL01974:Dusp27 APN 1 166100536 nonsense probably null
IGL02112:Dusp27 APN 1 166099671 nonsense probably null
IGL02805:Dusp27 APN 1 166099061 missense probably damaging 1.00
IGL03343:Dusp27 APN 1 166099448 missense probably benign 0.00
R0116:Dusp27 UTSW 1 166099701 missense probably benign 0.19
R0367:Dusp27 UTSW 1 166100763 missense probably benign 0.05
R0499:Dusp27 UTSW 1 166099101 missense probably benign 0.00
R0542:Dusp27 UTSW 1 166101284 missense possibly damaging 0.90
R1312:Dusp27 UTSW 1 166099291 missense possibly damaging 0.46
R1572:Dusp27 UTSW 1 166099455 missense possibly damaging 0.68
R1598:Dusp27 UTSW 1 166110259 missense probably benign 0.10
R1858:Dusp27 UTSW 1 166100846 missense possibly damaging 0.87
R2021:Dusp27 UTSW 1 166100823 missense probably benign 0.00
R2970:Dusp27 UTSW 1 166099229 missense probably benign 0.04
R3727:Dusp27 UTSW 1 166099506 missense probably damaging 1.00
R4041:Dusp27 UTSW 1 166100111 missense probably benign 0.01
R4245:Dusp27 UTSW 1 166101116 missense probably damaging 1.00
R4955:Dusp27 UTSW 1 166108092 missense probably damaging 1.00
R4967:Dusp27 UTSW 1 166127106 missense probably damaging 1.00
R5040:Dusp27 UTSW 1 166100345 missense probably benign 0.17
R5342:Dusp27 UTSW 1 166110250 missense probably benign 0.01
R5467:Dusp27 UTSW 1 166112030 critical splice donor site probably null
R5742:Dusp27 UTSW 1 166099454 missense probably benign 0.00
R6239:Dusp27 UTSW 1 166098819 missense probably damaging 1.00
R6531:Dusp27 UTSW 1 166110046 splice site probably null
R6586:Dusp27 UTSW 1 166100885 missense possibly damaging 0.79
R6958:Dusp27 UTSW 1 166107996 missense probably damaging 1.00
R7006:Dusp27 UTSW 1 166099094 missense probably benign
R7111:Dusp27 UTSW 1 166127154 missense possibly damaging 0.66
R7310:Dusp27 UTSW 1 166098731 missense possibly damaging 0.46
R7312:Dusp27 UTSW 1 166127107 missense probably damaging 0.99
R7378:Dusp27 UTSW 1 166112063 nonsense probably null
R7398:Dusp27 UTSW 1 166100475 missense probably damaging 1.00
R7442:Dusp27 UTSW 1 166101015 missense probably benign 0.01
R7569:Dusp27 UTSW 1 166108035 missense probably damaging 1.00
R7920:Dusp27 UTSW 1 166099896 missense possibly damaging 0.72
R7954:Dusp27 UTSW 1 166099280 missense probably benign 0.05
R7972:Dusp27 UTSW 1 166099139 missense probably damaging 1.00
R8186:Dusp27 UTSW 1 166100079 missense probably damaging 1.00
R8354:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
R8454:Dusp27 UTSW 1 166108133 missense probably damaging 1.00
Z1088:Dusp27 UTSW 1 166099283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCATGAATGGCTCTTGTCTC -3'
(R):5'- TTCACCCAGAGCTTCATGAG -3'

Sequencing Primer
(F):5'- CCACCCTACTGTCCAGGC -3'
(R):5'- GCTTCATGAGGTCTGAAGAGG -3'
Posted On2018-02-28