Incidental Mutation 'R6222:Olfr1186'
ID504066
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88499270 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 62 (Y62H)
Ref Sequence ENSEMBL: ENSMUSP00000074542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075025]
Predicted Effect probably benign
Transcript: ENSMUST00000075025
AA Change: Y62H

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074542
Gene: ENSMUSG00000057735
AA Change: Y62H

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 2.5e-51 PFAM
Pfam:7tm_1 38 284 4.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7044:Olfr1186 UTSW 2 88526486 missense probably benign
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
R7166:Olfr1186 UTSW 2 88525646 missense possibly damaging 0.89
R7387:Olfr1186 UTSW 2 88526400 nonsense probably null
R7891:Olfr1186 UTSW 2 88525945 missense probably benign 0.04
R7951:Olfr1186 UTSW 2 88525804 missense probably damaging 0.98
R7978:Olfr1186 UTSW 2 88525670 nonsense probably null
R8016:Olfr1186 UTSW 2 88526173 missense probably damaging 0.99
R8039:Olfr1186 UTSW 2 88525871 missense probably benign 0.07
R8389:Olfr1186 UTSW 2 88525587 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CTTCAGGGATTTCAAAGGGAAGTG -3'
(R):5'- CAATGGCCATGAGGATAAGCAC -3'

Sequencing Primer
(F):5'- TAGCCACTGATAGGATGCATAAC -3'
(R):5'- GGATAAGCACGAAGATCTCCATGC -3'
Posted On2018-02-28