Incidental Mutation 'R6222:Gm6871'
ID504079
Institutional Source Beutler Lab
Gene Symbol Gm6871
Ensembl Gene ENSMUSG00000090744
Gene Namepredicted gene 6871
Synonyms
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location41545674-41573662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41546582 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 244 (D244N)
Ref Sequence ENSEMBL: ENSMUSP00000105843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073410] [ENSMUST00000110214] [ENSMUST00000164677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073410
AA Change: D137N

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073117
Gene: ENSMUSG00000090744
AA Change: D137N

DomainStartEndE-ValueType
KRAB 4 64 1.19e-16 SMART
ZnF_C2H2 131 153 3.44e-4 SMART
ZnF_C2H2 159 181 5.99e-4 SMART
ZnF_C2H2 187 209 3.34e-2 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 1.28e-3 SMART
ZnF_C2H2 271 293 3.69e-4 SMART
ZnF_C2H2 299 321 1.36e-2 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 3.16e-3 SMART
ZnF_C2H2 411 433 5.14e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110214
AA Change: D244N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105843
Gene: ENSMUSG00000090744
AA Change: D244N

DomainStartEndE-ValueType
KRAB 111 171 1.19e-16 SMART
ZnF_C2H2 238 260 3.44e-4 SMART
ZnF_C2H2 266 288 5.99e-4 SMART
ZnF_C2H2 294 316 3.34e-2 SMART
ZnF_C2H2 322 344 5.99e-4 SMART
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 3.21e-4 SMART
ZnF_C2H2 462 484 2.61e-4 SMART
ZnF_C2H2 490 512 3.16e-3 SMART
ZnF_C2H2 518 540 5.14e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000164677
SMART Domains Protein: ENSMUSP00000131240
Gene: ENSMUSG00000090744

DomainStartEndE-ValueType
internal_repeat_1 21 67 6.62e-7 PROSPERO
internal_repeat_1 105 151 6.62e-7 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Gm6871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gm6871 APN 7 41546421 missense possibly damaging 0.67
R0419:Gm6871 UTSW 7 41573445 missense probably benign 0.00
R1005:Gm6871 UTSW 7 41546258 missense probably damaging 1.00
R1544:Gm6871 UTSW 7 41546090 splice site probably null
R1553:Gm6871 UTSW 7 41546398 missense probably benign 0.00
R1674:Gm6871 UTSW 7 41573635 missense possibly damaging 0.46
R1710:Gm6871 UTSW 7 41546477 missense probably damaging 1.00
R1743:Gm6871 UTSW 7 41546452 missense probably damaging 0.98
R1777:Gm6871 UTSW 7 41545719 missense probably benign 0.23
R1844:Gm6871 UTSW 7 41573468 missense probably benign 0.03
R2508:Gm6871 UTSW 7 41547990 missense probably benign 0.11
R2966:Gm6871 UTSW 7 41573440 missense probably benign 0.07
R3155:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3156:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3967:Gm6871 UTSW 7 41546724 missense probably damaging 0.99
R4156:Gm6871 UTSW 7 41546086 missense probably damaging 0.96
R4238:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4239:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4240:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4731:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4732:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4733:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4910:Gm6871 UTSW 7 41573592 missense probably benign 0.03
R5269:Gm6871 UTSW 7 41548101 missense probably damaging 0.99
R5371:Gm6871 UTSW 7 41573568 missense probably benign 0.07
R6975:Gm6871 UTSW 7 41546778 synonymous silent
R8006:Gm6871 UTSW 7 41545682 missense probably benign 0.10
R8150:Gm6871 UTSW 7 41547761 missense
Z1176:Gm6871 UTSW 7 41546413 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTTACCACATTGATCACATTC -3'
(R):5'- TTATTGCAGGCACCAAACAAGTC -3'

Sequencing Primer
(F):5'- CCACATTGATCACATTCATAGGG -3'
(R):5'- GGCACCAAACAAGTCATGCAGG -3'
Posted On2018-02-28