Incidental Mutation 'R6222:Ing2'
ID504081
Institutional Source Beutler Lab
Gene Symbol Ing2
Ensembl Gene ENSMUSG00000063049
Gene Nameinhibitor of growth family, member 2
SynonymsIng1l, P33ING2, 2810011M06Rik, ING2
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location47667178-47675556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47668931 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 194 (K194R)
Ref Sequence ENSEMBL: ENSMUSP00000079226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080353]
PDB Structure
Solution structure of PHD domain in inhibitor of growth family, member 1-like [SOLUTION NMR]
Crystal structure of ING2 PHD finger in complex with H3K4Me3 peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080353
AA Change: K194R

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079226
Gene: ENSMUSG00000063049
AA Change: K194R

DomainStartEndE-ValueType
Pfam:ING 28 126 2e-26 PFAM
low complexity region 143 162 N/A INTRINSIC
low complexity region 180 201 N/A INTRINSIC
PHD 215 260 5.1e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125536
SMART Domains Protein: ENSMUSP00000124792
Gene: ENSMUSG00000063049

DomainStartEndE-ValueType
low complexity region 36 55 N/A INTRINSIC
low complexity region 73 94 N/A INTRINSIC
Pfam:PHD 108 145 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146625
SMART Domains Protein: ENSMUSP00000124454
Gene: ENSMUSG00000063049

DomainStartEndE-ValueType
low complexity region 36 55 N/A INTRINSIC
low complexity region 73 94 N/A INTRINSIC
PHD 108 153 7.99e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inhibitor of growth (ING) family. Members of the ING family associate with and modulate the activity of histone acetyltransferase (HAT) and histone deacetylase (HDAC) complexes and function in DNA repair and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes impaired spermatogenesis and male infertility associated with teratozoospermia, seminiferous tubule degeneration, germ cell depletion, arrest of male meiosis and enhanced testicular apoptosis, and leads to an increased incidence of soft tissue sarcomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Ing2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Ing2 APN 8 47669261 missense possibly damaging 0.92
IGL01791:Ing2 APN 8 47669035 missense probably benign 0.02
IGL02477:Ing2 APN 8 47669268 missense possibly damaging 0.95
PIT4418001:Ing2 UTSW 8 47669090 missense probably benign 0.03
R0315:Ing2 UTSW 8 47669090 missense probably benign 0.06
R1793:Ing2 UTSW 8 47669329 missense probably damaging 1.00
R5521:Ing2 UTSW 8 47669213 missense probably damaging 1.00
R5759:Ing2 UTSW 8 47669005 missense possibly damaging 0.71
R5821:Ing2 UTSW 8 47668826 missense probably benign 0.32
R6378:Ing2 UTSW 8 47669258 missense probably benign 0.32
R7031:Ing2 UTSW 8 47668823 missense probably benign 0.31
R7243:Ing2 UTSW 8 47674539 missense probably damaging 0.98
R7819:Ing2 UTSW 8 47669028 missense probably damaging 1.00
X0036:Ing2 UTSW 8 47674507 missense probably null 0.94
Predicted Primers PCR Primer
(F):5'- GGGCAATACCATTTCCCCTTG -3'
(R):5'- AGTGTTTCCAGGATCCTGCTG -3'

Sequencing Primer
(F):5'- CTTGGGTTTATAGGTGAGTGAAACAC -3'
(R):5'- TCCAGGATCCTGCTGAAAGTG -3'
Posted On2018-02-28