Incidental Mutation 'R6222:Nol11'
ID504094
Institutional Source Beutler Lab
Gene Symbol Nol11
Ensembl Gene ENSMUSG00000018433
Gene Namenucleolar protein 11
Synonyms1500002M01Rik
MMRRC Submission 044353-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location107166663-107189381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107171616 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 598 (T598K)
Ref Sequence ENSEMBL: ENSMUSP00000102368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018577] [ENSMUST00000106757]
Predicted Effect probably benign
Transcript: ENSMUST00000018577
AA Change: T618K

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018577
Gene: ENSMUSG00000018433
AA Change: T618K

DomainStartEndE-ValueType
SCOP:d1jmxb_ 32 176 3e-3 SMART
Pfam:NUC205 200 243 3.7e-26 PFAM
low complexity region 619 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106757
AA Change: T598K

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102368
Gene: ENSMUSG00000018433
AA Change: T598K

DomainStartEndE-ValueType
SCOP:d1jmxb_ 32 176 3e-3 SMART
Pfam:NUC205 200 243 7.3e-29 PFAM
low complexity region 599 609 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129501
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Nol11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Nol11 APN 11 107173460 missense probably benign
IGL01656:Nol11 APN 11 107189172 missense probably benign 0.00
IGL01687:Nol11 APN 11 107186869 missense probably damaging 0.97
IGL02179:Nol11 APN 11 107189256 start codon destroyed probably null 1.00
IGL02538:Nol11 APN 11 107173373 missense probably benign 0.02
IGL03395:Nol11 APN 11 107175722 missense probably benign 0.06
R0526:Nol11 UTSW 11 107184771 nonsense probably null
R1734:Nol11 UTSW 11 107175623 missense possibly damaging 0.80
R2143:Nol11 UTSW 11 107181055 missense probably benign 0.03
R2385:Nol11 UTSW 11 107189206 missense probably benign 0.40
R3036:Nol11 UTSW 11 107173244 missense possibly damaging 0.87
R3522:Nol11 UTSW 11 107173628 missense possibly damaging 0.94
R3895:Nol11 UTSW 11 107168347 missense probably damaging 1.00
R4404:Nol11 UTSW 11 107173725 missense probably damaging 1.00
R4664:Nol11 UTSW 11 107181000 missense possibly damaging 0.89
R4705:Nol11 UTSW 11 107184718 intron probably benign
R5704:Nol11 UTSW 11 107173369 missense probably benign 0.43
R5991:Nol11 UTSW 11 107171145 missense probably benign 0.02
R6221:Nol11 UTSW 11 107171616 missense possibly damaging 0.50
R6223:Nol11 UTSW 11 107171616 missense possibly damaging 0.50
R6285:Nol11 UTSW 11 107181034 missense probably benign 0.01
R6467:Nol11 UTSW 11 107181086 missense possibly damaging 0.95
R7080:Nol11 UTSW 11 107180052 missense probably damaging 1.00
R7679:Nol11 UTSW 11 107173316 missense probably benign 0.00
R7767:Nol11 UTSW 11 107179082 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACAGAGCACATCAAGGTTGATC -3'
(R):5'- AAAGCATTGTTTACGAGTGCG -3'

Sequencing Primer
(F):5'- GGTTGATCACCCCCAAACC -3'
(R):5'- CTCTGACAGCAGCAGAGTATTGAC -3'
Posted On2018-02-28