Incidental Mutation 'R6222:Abcc4'
ID504101
Institutional Source Beutler Lab
Gene Symbol Abcc4
Ensembl Gene ENSMUSG00000032849
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 4
SynonymsMRP4, D630049P08Rik, MOAT-B
MMRRC Submission 044353-MU
Accession Numbers

Genbank: NM_001033336.3, NM_001163675.1, NM_001163676.1; Ensembl: ENSMUST00000036554

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location118482692-118706219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118529956 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 903 (H903L)
Ref Sequence ENSEMBL: ENSMUSP00000042186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036554] [ENSMUST00000166646]
Predicted Effect probably damaging
Transcript: ENSMUST00000036554
AA Change: H903L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042186
Gene: ENSMUSG00000032849
AA Change: H903L

DomainStartEndE-ValueType
Pfam:ABC_membrane 92 365 4.5e-37 PFAM
AAA 437 610 5.71e-12 SMART
Pfam:ABC_membrane 714 993 4.2e-47 PFAM
AAA 1067 1251 2.02e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166646
AA Change: H828L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129677
Gene: ENSMUSG00000032849
AA Change: H828L

DomainStartEndE-ValueType
Pfam:ABC_membrane 98 290 4.1e-22 PFAM
AAA 362 535 5.71e-12 SMART
Pfam:ABC_membrane 638 922 4.6e-39 PFAM
AAA 992 1176 2.02e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228848
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are viable and fertile. Homozygotes for one null allele display impaired organic anion transport in the blood-brain and blood-cerebrospinal fluid barriers and kidney. Homozygotes for a second null allele display hypoalgesia and abnormal PGE2 physiology. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted, knock-out(2) Gene trapped(141)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gbe1 T C 16: 70,529,012 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Abcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Abcc4 APN 14 118528997 missense probably benign 0.03
IGL01152:Abcc4 APN 14 118599385 missense probably damaging 1.00
IGL01511:Abcc4 APN 14 118599341 missense probably benign 0.03
IGL01604:Abcc4 APN 14 118527994 missense possibly damaging 0.94
IGL01725:Abcc4 APN 14 118500829 missense probably damaging 1.00
IGL01828:Abcc4 APN 14 118553279 splice site probably benign
IGL02174:Abcc4 APN 14 118500742 missense probably damaging 0.98
IGL02391:Abcc4 APN 14 118553352 missense probably damaging 1.00
IGL02500:Abcc4 APN 14 118618926 missense possibly damaging 0.47
IGL02598:Abcc4 APN 14 118668369 nonsense probably null
IGL02668:Abcc4 APN 14 118611475 missense probably damaging 1.00
IGL02708:Abcc4 APN 14 118500801 missense probably damaging 1.00
IGL02859:Abcc4 APN 14 118516500 missense probably damaging 1.00
IGL03249:Abcc4 APN 14 118627706 splice site probably benign
IGL03257:Abcc4 APN 14 118615211 missense probably benign 0.01
IGL03298:Abcc4 APN 14 118611468 missense probably damaging 1.00
1mM(1):Abcc4 UTSW 14 118629656 nonsense probably null
R0743:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R0884:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R1139:Abcc4 UTSW 14 118500840 missense possibly damaging 0.56
R1238:Abcc4 UTSW 14 118597639 splice site probably benign
R1588:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R1678:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R1785:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1786:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1961:Abcc4 UTSW 14 118611456 missense probably damaging 0.98
R1961:Abcc4 UTSW 14 118611459 missense possibly damaging 0.92
R1993:Abcc4 UTSW 14 118526282 missense probably benign 0.02
R2025:Abcc4 UTSW 14 118553325 missense probably benign 0.13
R3613:Abcc4 UTSW 14 118627451 critical splice donor site probably null
R3864:Abcc4 UTSW 14 118616415 missense probably benign
R4274:Abcc4 UTSW 14 118629622 missense probably damaging 1.00
R4459:Abcc4 UTSW 14 118599393 missense probably benign 0.11
R4601:Abcc4 UTSW 14 118632163 missense probably benign 0.00
R4665:Abcc4 UTSW 14 118529002 missense probably benign
R4678:Abcc4 UTSW 14 118627691 missense probably damaging 0.97
R4771:Abcc4 UTSW 14 118484384 missense probably benign 0.00
R4962:Abcc4 UTSW 14 118668399 missense probably benign 0.33
R4997:Abcc4 UTSW 14 118516503 nonsense probably null
R5273:Abcc4 UTSW 14 118594821 missense possibly damaging 0.76
R5526:Abcc4 UTSW 14 118631037 missense probably benign 0.10
R5652:Abcc4 UTSW 14 118618927 missense probably benign 0.00
R5820:Abcc4 UTSW 14 118604195 missense probably benign 0.14
R5873:Abcc4 UTSW 14 118526290 missense probably benign 0.00
R6008:Abcc4 UTSW 14 118490566 missense possibly damaging 0.63
R6080:Abcc4 UTSW 14 118669050 missense possibly damaging 0.75
R6919:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R6931:Abcc4 UTSW 14 118527988 missense probably damaging 0.99
R7013:Abcc4 UTSW 14 118526343 missense probably benign
R7055:Abcc4 UTSW 14 118594785 nonsense probably null
R7146:Abcc4 UTSW 14 118615181 missense probably damaging 1.00
R7365:Abcc4 UTSW 14 118627654 missense probably damaging 1.00
R7402:Abcc4 UTSW 14 118706075 missense probably damaging 1.00
R7438:Abcc4 UTSW 14 118616446 missense probably benign 0.01
R7528:Abcc4 UTSW 14 118529905 missense probably damaging 0.99
R7674:Abcc4 UTSW 14 118611487 missense probably damaging 1.00
R7769:Abcc4 UTSW 14 118615270 frame shift probably null
R7823:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R7847:Abcc4 UTSW 14 118627480 missense probably damaging 1.00
R7989:Abcc4 UTSW 14 118599360 missense probably benign 0.05
R8044:Abcc4 UTSW 14 118615270 frame shift probably null
R8214:Abcc4 UTSW 14 118500841 missense probably benign 0.35
R8264:Abcc4 UTSW 14 118594842 missense possibly damaging 0.81
R8309:Abcc4 UTSW 14 118616392 missense probably damaging 1.00
R8369:Abcc4 UTSW 14 118627457 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAACTGATTGGCCACAGGG -3'
(R):5'- CTCACTTTGGAGCATGGGAG -3'

Sequencing Primer
(F):5'- GGGCTCAAACCTAAGCGC -3'
(R):5'- AACCTCACTGTGGAGCGTG -3'
Posted On2018-02-28