Incidental Mutation 'R6222:Gbe1'
ID504106
Institutional Source Beutler Lab
Gene Symbol Gbe1
Ensembl Gene ENSMUSG00000022707
Gene Nameglucan (1,4-alpha-), branching enzyme 1
Synonyms2310045H19Rik, D16Ertd536e, 2810426P10Rik
MMRRC Submission 044353-MU
Accession Numbers

Ncbi RefSeq: NM_028803.3; MGI:1921435

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6222 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location70313949-70569716 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 70529012 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023393] [ENSMUST00000163832] [ENSMUST00000170464] [ENSMUST00000171132]
Predicted Effect probably benign
Transcript: ENSMUST00000023393
SMART Domains Protein: ENSMUSP00000023393
Gene: ENSMUSG00000022707

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163832
SMART Domains Protein: ENSMUSP00000132603
Gene: ENSMUSG00000022707

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 6e-19 PFAM
Pfam:Alpha-amylase 220 337 5.9e-14 PFAM
Pfam:Alpha-amylase_C 603 698 2.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164300
Predicted Effect probably benign
Transcript: ENSMUST00000170464
SMART Domains Protein: ENSMUSP00000131320
Gene: ENSMUSG00000022707

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 9.4e-17 PFAM
Pfam:Alpha-amylase 218 336 1.1e-17 PFAM
Pfam:Alpha-amylase_C 603 698 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171132
AA Change: Y646H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127642
Gene: ENSMUSG00000022707
AA Change: Y646H

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CBM_48 75 161 1.8e-17 PFAM
Pfam:Alpha-amylase 218 338 2.7e-18 PFAM
Pfam:Alpha-amylase_C 603 650 4.1e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype Strain: 4868492; 5293612
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen branching enzyme that catalyzes the transfer of alpha-1,4-linked glucosyl units from the outer end of a glycogen chain to an alpha-1,6 position on the same or a neighboring glycogen chain. Branching of the chains is essential to increase the solubility of the glycogen molecule and, consequently, in reducing the osmotic pressure within cells. Highest level of this enzyme are found in liver and muscle. Mutations in this gene are associated with glycogen storage disease IV (also known as Andersen's disease). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit mid-to-late gestation lethality, decreased heart rate, glycogen storage defects, and ventricles that were small, hypertrabeculated, and noncompacted. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,809,966 *217W probably null Het
Abcc3 A G 11: 94,368,605 F337L probably benign Het
Abcc4 T A 14: 118,529,956 H903L probably damaging Het
Akap7 T A 10: 25,283,946 K119* probably null Het
Als2 T C 1: 59,180,125 D1222G probably benign Het
Ano4 T C 10: 89,027,222 Y296C probably damaging Het
Arid1b A G 17: 5,327,647 probably null Het
Arl10 T C 13: 54,578,831 F141L probably damaging Het
B130006D01Rik T C 11: 95,726,162 probably benign Het
Bbs9 T A 9: 22,567,851 S197T possibly damaging Het
Bicd1 A T 6: 149,512,965 D392V probably damaging Het
Bmi1 T A 2: 18,683,702 M168K possibly damaging Het
C7 A T 15: 5,011,941 D494E possibly damaging Het
Cacna1s A T 1: 136,104,622 N1221I probably benign Het
Cacng7 A G 7: 3,336,612 T10A probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdpf1 T C 15: 85,807,442 R108G possibly damaging Het
Ceacam5 A T 7: 17,745,547 K196N probably benign Het
Cftr A C 6: 18,282,501 T1067P probably benign Het
Cma2 T C 14: 55,973,192 I112T possibly damaging Het
Cntnap4 A G 8: 112,842,721 S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 Y627* probably null Het
Dusp27 G T 1: 166,098,645 Q1133K probably benign Het
Fam204a A G 19: 60,199,968 probably null Het
Galnt1 T A 18: 24,264,534 probably null Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Gm6871 C T 7: 41,546,582 D244N probably damaging Het
Gna15 T C 10: 81,512,046 T189A probably damaging Het
Igsf10 C T 3: 59,318,915 D2446N possibly damaging Het
Ing2 T C 8: 47,668,931 K194R possibly damaging Het
Ino80d G A 1: 63,058,525 H737Y probably damaging Het
Izumo4 C T 10: 80,703,051 R83W probably damaging Het
Kcnt1 G A 2: 25,892,510 V219M probably damaging Het
Kiz A T 2: 146,891,061 S386C probably damaging Het
Ldlrap1 C T 4: 134,757,360 E108K probably damaging Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfr1186 T C 2: 88,499,270 Y62H probably benign Het
Olfr1368 T C 13: 21,142,877 Y60C probably damaging Het
Pdzd2 T C 15: 12,374,566 K1828E probably damaging Het
Prl3a1 T C 13: 27,276,114 F194L probably benign Het
Reg1 A T 6: 78,427,374 Q77L probably benign Het
Ruvbl2 G T 7: 45,424,725 D248E probably damaging Het
Sart3 C T 5: 113,743,206 A938T probably benign Het
Serpinb5 T A 1: 106,870,340 C20S probably benign Het
Sh2d4b A C 14: 40,820,737 S361A probably damaging Het
Snx2 T A 18: 53,199,824 L190* probably null Het
Sorcs3 A T 19: 48,759,857 Y755F possibly damaging Het
Tiam2 A G 17: 3,453,338 Q930R probably damaging Het
Tll1 C A 8: 64,098,534 G271V probably benign Het
Tmem116 C T 5: 121,491,108 T188M probably benign Het
Tmem181a T C 17: 6,300,917 V367A probably benign Het
Umodl1 T C 17: 31,002,892 probably null Het
Virma C T 4: 11,527,820 A1187V probably damaging Het
Wdr53 T C 16: 32,256,664 V229A probably benign Het
Zcchc10 T C 11: 53,332,462 probably benign Het
Other mutations in Gbe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Gbe1 APN 16 70478369 missense probably damaging 1.00
IGL01783:Gbe1 APN 16 70401855 critical splice donor site probably null
IGL02437:Gbe1 APN 16 70434658 splice site probably benign
IGL02635:Gbe1 APN 16 70569014 missense probably damaging 1.00
IGL02836:Gbe1 APN 16 70561095 missense possibly damaging 0.90
IGL03331:Gbe1 APN 16 70433578 missense probably damaging 1.00
IGL03138:Gbe1 UTSW 16 70529063 utr 3 prime probably benign
PIT4515001:Gbe1 UTSW 16 70441116 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0044:Gbe1 UTSW 16 70561132 nonsense probably null
R0131:Gbe1 UTSW 16 70360852 splice site probably benign
R0178:Gbe1 UTSW 16 70478386 missense probably damaging 1.00
R0374:Gbe1 UTSW 16 70483914 missense probably benign 0.09
R1036:Gbe1 UTSW 16 70528887 missense probably damaging 1.00
R1162:Gbe1 UTSW 16 70381850 intron probably benign
R1759:Gbe1 UTSW 16 70488041 missense probably benign 0.11
R1780:Gbe1 UTSW 16 70495324 nonsense probably null
R1998:Gbe1 UTSW 16 70569041 missense probably damaging 1.00
R2001:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2002:Gbe1 UTSW 16 70528926 missense probably damaging 1.00
R2269:Gbe1 UTSW 16 70436952 missense probably damaging 1.00
R2353:Gbe1 UTSW 16 70437021 splice site probably null
R2434:Gbe1 UTSW 16 70441212 missense probably damaging 1.00
R4114:Gbe1 UTSW 16 70483827 missense possibly damaging 0.64
R4528:Gbe1 UTSW 16 70478337 missense probably benign
R4736:Gbe1 UTSW 16 70495253 missense probably damaging 1.00
R4859:Gbe1 UTSW 16 70478401 missense probably damaging 1.00
R5884:Gbe1 UTSW 16 70528875 splice site probably null
R6527:Gbe1 UTSW 16 70433672 critical splice donor site probably null
R6770:Gbe1 UTSW 16 70314265 missense possibly damaging 0.86
R6770:Gbe1 UTSW 16 70401838 missense probably damaging 1.00
R6941:Gbe1 UTSW 16 70433556 small deletion probably benign
R7193:Gbe1 UTSW 16 70495370 missense probably damaging 1.00
R7232:Gbe1 UTSW 16 70436940 missense possibly damaging 0.91
R7343:Gbe1 UTSW 16 70361015 missense probably benign 0.09
R7810:Gbe1 UTSW 16 70527197 missense possibly damaging 0.92
R7822:Gbe1 UTSW 16 70433612 missense probably damaging 0.98
R7876:Gbe1 UTSW 16 70441171 missense probably benign
R8319:Gbe1 UTSW 16 70488076 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTAATAACGAGCCACCATTATTGTG -3'
(R):5'- TCGTAGATCATAAACCATTCAGTCC -3'

Sequencing Primer
(F):5'- CGAGCCACCATTATTGTGTTAAG -3'
(R):5'- GTCCAAATTAGCTAAGCAAGGTTAGC -3'
Posted On2018-02-28