Mutagenetix > Incidental Mutations

Incidental Mutation 'R6222:Tiam2'

504107

Institutional Source

Beutler Lab

Gene Symbol

Tiam2

Ensembl Gene

ENSMUSG00000023800

Gene Name

T cell lymphoma invasion and metastasis 2

Synonyms

3000002F19Rik, STEF

MMRRC Submission

044353-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6222 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3326573-3531344 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3453338 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 930 (Q930R)

Ref Sequence

ENSEMBL: ENSMUSP00000125842 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072156
AA Change: Q930R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: Q930R

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169838
AA Change: Q930R

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: Q930R

Domain	Start	End	E-Value	Type
low complexity region	230	245	N/A	INTRINSIC
low complexity region	267	281	N/A	INTRINSIC
low complexity region	471	492	N/A	INTRINSIC
PH	505	620	7.82e-16	SMART
RBD	831	902	1.32e-26	SMART
PDZ	921	995	2.38e-7	SMART
RhoGEF	1124	1313	2.23e-61	SMART
PH	1347	1478	2.86e0	SMART
low complexity region	1522	1532	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000227405

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930596D02Rik	T	C	14: 35,809,966	*217W	probably null	Het
Abcc3	A	G	11: 94,368,605	F337L	probably benign	Het
Abcc4	T	A	14: 118,529,956	H903L	probably damaging	Het
Akap7	T	A	10: 25,283,946	K119*	probably null	Het
Als2	T	C	1: 59,180,125	D1222G	probably benign	Het
Ano4	T	C	10: 89,027,222	Y296C	probably damaging	Het
Arid1b	A	G	17: 5,327,647		probably null	Het
Arl10	T	C	13: 54,578,831	F141L	probably damaging	Het
B130006D01Rik	T	C	11: 95,726,162		probably benign	Het
Bbs9	T	A	9: 22,567,851	S197T	possibly damaging	Het
Bicd1	A	T	6: 149,512,965	D392V	probably damaging	Het
Bmi1	T	A	2: 18,683,702	M168K	possibly damaging	Het
C7	A	T	15: 5,011,941	D494E	possibly damaging	Het
Cacna1s	A	T	1: 136,104,622	N1221I	probably benign	Het
Cacng7	A	G	7: 3,336,612	T10A	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdpf1	T	C	15: 85,807,442	R108G	possibly damaging	Het
Ceacam5	A	T	7: 17,745,547	K196N	probably benign	Het
Cftr	A	C	6: 18,282,501	T1067P	probably benign	Het
Cma2	T	C	14: 55,973,192	I112T	possibly damaging	Het
Cntnap4	A	G	8: 112,842,721	S916G	probably damaging	Het
Cwf19l2	T	A	9: 3,454,569	Y627*	probably null	Het
Dusp27	G	T	1: 166,098,645	Q1133K	probably benign	Het
Fam204a	A	G	19: 60,199,968		probably null	Het
Galnt1	T	A	18: 24,264,534		probably null	Het
Gbe1	T	C	16: 70,529,012		probably null	Het
Gm5771	A	T	6: 41,397,166	Y234F	probably damaging	Het
Gm6871	C	T	7: 41,546,582	D244N	probably damaging	Het
Gna15	T	C	10: 81,512,046	T189A	probably damaging	Het
Igsf10	C	T	3: 59,318,915	D2446N	possibly damaging	Het
Ing2	T	C	8: 47,668,931	K194R	possibly damaging	Het
Ino80d	G	A	1: 63,058,525	H737Y	probably damaging	Het
Izumo4	C	T	10: 80,703,051	R83W	probably damaging	Het
Kcnt1	G	A	2: 25,892,510	V219M	probably damaging	Het
Kiz	A	T	2: 146,891,061	S386C	probably damaging	Het
Ldlrap1	C	T	4: 134,757,360	E108K	probably damaging	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfr1186	T	C	2: 88,499,270	Y62H	probably benign	Het
Olfr1368	T	C	13: 21,142,877	Y60C	probably damaging	Het
Pdzd2	T	C	15: 12,374,566	K1828E	probably damaging	Het
Prl3a1	T	C	13: 27,276,114	F194L	probably benign	Het
Reg1	A	T	6: 78,427,374	Q77L	probably benign	Het
Ruvbl2	G	T	7: 45,424,725	D248E	probably damaging	Het
Sart3	C	T	5: 113,743,206	A938T	probably benign	Het
Serpinb5	T	A	1: 106,870,340	C20S	probably benign	Het
Sh2d4b	A	C	14: 40,820,737	S361A	probably damaging	Het
Snx2	T	A	18: 53,199,824	L190*	probably null	Het
Sorcs3	A	T	19: 48,759,857	Y755F	possibly damaging	Het
Tll1	C	A	8: 64,098,534	G271V	probably benign	Het
Tmem116	C	T	5: 121,491,108	T188M	probably benign	Het
Tmem181a	T	C	17: 6,300,917	V367A	probably benign	Het
Umodl1	T	C	17: 31,002,892		probably null	Het
Virma	C	T	4: 11,527,820	A1187V	probably damaging	Het
Wdr53	T	C	16: 32,256,664	V229A	probably benign	Het
Zcchc10	T	C	11: 53,332,462		probably benign	Het

Other mutations in Tiam2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Tiam2	APN	17	3415028	missense	probably benign	0.21
IGL01320:Tiam2	APN	17	3505745	missense	probably damaging	1.00
IGL01384:Tiam2	APN	17	3427202	missense	probably benign	0.08
IGL01575:Tiam2	APN	17	3454316	missense	probably damaging	1.00
IGL01769:Tiam2	APN	17	3427290	missense	probably damaging	1.00
IGL02395:Tiam2	APN	17	3421481	missense	possibly damaging	0.49
IGL02652:Tiam2	APN	17	3439696	splice site	probably benign
IGL03102:Tiam2	APN	17	3509548	missense	probably damaging	1.00
IGL03222:Tiam2	APN	17	3438708	missense	probably damaging	0.97
Feste_burg	UTSW	17	3414622	frame shift	probably null
R0257:Tiam2	UTSW	17	3450813	missense	possibly damaging	0.49
R0420:Tiam2	UTSW	17	3502918	missense	probably benign	0.01
R0528:Tiam2	UTSW	17	3511071	missense	probably damaging	1.00
R0532:Tiam2	UTSW	17	3421646	missense	probably damaging	1.00
R0551:Tiam2	UTSW	17	3428954	missense	probably damaging	1.00
R0554:Tiam2	UTSW	17	3438681	nonsense	probably null
R0645:Tiam2	UTSW	17	3514698	missense	possibly damaging	0.92
R0726:Tiam2	UTSW	17	3512833	unclassified	probably benign
R1139:Tiam2	UTSW	17	3477267	missense	possibly damaging	0.55
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1392:Tiam2	UTSW	17	3414197	missense	possibly damaging	0.71
R1529:Tiam2	UTSW	17	3516703	missense	probably benign	0.00
R1671:Tiam2	UTSW	17	3506834	missense	probably damaging	1.00
R1731:Tiam2	UTSW	17	3518423	missense	probably damaging	0.98
R1759:Tiam2	UTSW	17	3516003	missense	probably damaging	0.98
R1850:Tiam2	UTSW	17	3437235	missense	probably damaging	1.00
R1853:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1855:Tiam2	UTSW	17	3415135	missense	probably damaging	1.00
R1931:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1932:Tiam2	UTSW	17	3514725	missense	possibly damaging	0.68
R1993:Tiam2	UTSW	17	3415126	nonsense	probably null
R2211:Tiam2	UTSW	17	3414918	nonsense	probably null
R2217:Tiam2	UTSW	17	3415114	missense	probably benign	0.34
R2278:Tiam2	UTSW	17	3427220	missense	probably damaging	0.96
R2407:Tiam2	UTSW	17	3477261	missense	probably benign	0.14
R2516:Tiam2	UTSW	17	3453382	missense	probably damaging	1.00
R2991:Tiam2	UTSW	17	3518250	missense	probably benign
R3086:Tiam2	UTSW	17	3421582	missense	probably damaging	1.00
R3121:Tiam2	UTSW	17	3439702	missense	probably benign	0.01
R3686:Tiam2	UTSW	17	3421684	missense	possibly damaging	0.87
R3740:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3742:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R3826:Tiam2	UTSW	17	3507701	splice site	probably benign
R3829:Tiam2	UTSW	17	3507701	splice site	probably benign
R3844:Tiam2	UTSW	17	3421651	missense	probably damaging	0.98
R3970:Tiam2	UTSW	17	3428831	missense	probably damaging	1.00
R4060:Tiam2	UTSW	17	3428980	missense	probably benign	0.00
R4296:Tiam2	UTSW	17	3450845	missense	probably benign
R4357:Tiam2	UTSW	17	3450853	missense	probably damaging	1.00
R4368:Tiam2	UTSW	17	3414683	missense	probably benign	0.01
R4369:Tiam2	UTSW	17	3413967	start gained	probably benign
R4524:Tiam2	UTSW	17	3514711	missense	probably damaging	1.00
R4619:Tiam2	UTSW	17	3518342	missense	probably damaging	1.00
R4715:Tiam2	UTSW	17	3454168	missense	probably damaging	1.00
R4723:Tiam2	UTSW	17	3450317	missense	probably benign	0.00
R4979:Tiam2	UTSW	17	3505710	missense	probably damaging	1.00
R5182:Tiam2	UTSW	17	3438721	missense	probably damaging	1.00
R5451:Tiam2	UTSW	17	3428996	missense	probably damaging	1.00
R5728:Tiam2	UTSW	17	3414956	missense	probably damaging	0.99
R5827:Tiam2	UTSW	17	3448489	missense	probably benign	0.00
R5879:Tiam2	UTSW	17	3437265	missense	probably damaging	1.00
R5960:Tiam2	UTSW	17	3438640	missense	probably benign	0.24
R5974:Tiam2	UTSW	17	3414809	missense	possibly damaging	0.51
R6198:Tiam2	UTSW	17	3414121	missense	probably benign	0.06
R6295:Tiam2	UTSW	17	3509556	missense	probably damaging	1.00
R6355:Tiam2	UTSW	17	3414622	frame shift	probably null
R6356:Tiam2	UTSW	17	3414622	frame shift	probably null
R6454:Tiam2	UTSW	17	3438663	missense	probably benign	0.00
R6497:Tiam2	UTSW	17	3506827	missense	probably damaging	1.00
R6579:Tiam2	UTSW	17	3414622	frame shift	probably null
R6580:Tiam2	UTSW	17	3414622	frame shift	probably null
R6581:Tiam2	UTSW	17	3414622	frame shift	probably null
R6582:Tiam2	UTSW	17	3414622	frame shift	probably null
R6648:Tiam2	UTSW	17	3506873	missense	probably damaging	1.00
R6705:Tiam2	UTSW	17	3518243	missense	probably benign	0.01
R6758:Tiam2	UTSW	17	3518403	missense	probably benign	0.01
R6836:Tiam2	UTSW	17	3414380	missense	probably benign	0.17
R6924:Tiam2	UTSW	17	3507795	missense	probably damaging	1.00
R6977:Tiam2	UTSW	17	3518659	missense	probably damaging	1.00
R7051:Tiam2	UTSW	17	3448483	missense	probably damaging	0.99
R7151:Tiam2	UTSW	17	3448385	missense	probably benign	0.36
R7214:Tiam2	UTSW	17	3518412	missense	possibly damaging	0.85
R7332:Tiam2	UTSW	17	3453369	missense	probably damaging	1.00
R7334:Tiam2	UTSW	17	3503008	missense	possibly damaging	0.92
R7414:Tiam2	UTSW	17	3414113	missense	possibly damaging	0.54
R7660:Tiam2	UTSW	17	3482605	start codon destroyed	probably null	0.66
R7743:Tiam2	UTSW	17	3518156	missense	possibly damaging	0.53
R7755:Tiam2	UTSW	17	3421316	missense	probably benign	0.01
R7805:Tiam2	UTSW	17	3509410	missense	probably damaging	1.00
R7813:Tiam2	UTSW	17	3437247	missense	probably damaging	1.00
R7842:Tiam2	UTSW	17	3518124	missense	possibly damaging	0.82
R7989:Tiam2	UTSW	17	3518249	nonsense	probably null
R8011:Tiam2	UTSW	17	3448396	missense	possibly damaging	0.92
R8221:Tiam2	UTSW	17	3518585	missense	probably damaging	0.99
R8260:Tiam2	UTSW	17	3518319	missense	possibly damaging	0.94
R8292:Tiam2	UTSW	17	3506867	missense	probably benign	0.01
R8406:Tiam2	UTSW	17	3507790	missense	possibly damaging	0.94
R8424:Tiam2	UTSW	17	3516041	missense	probably damaging	1.00
R8424:Tiam2	UTSW	17	3516042	missense	probably damaging	1.00
R8430:Tiam2	UTSW	17	3518262	missense	probably benign	0.05
R8530:Tiam2	UTSW	17	3450812	missense	probably benign	0.03
X0027:Tiam2	UTSW	17	3414000	start codon destroyed	probably null	1.00
X0060:Tiam2	UTSW	17	3450354	splice site	probably null
X0065:Tiam2	UTSW	17	3505708	missense	probably damaging	1.00
Z1088:Tiam2	UTSW	17	3415019	missense	probably benign	0.01
Z1176:Tiam2	UTSW	17	3505776	missense	probably null	1.00
Z1177:Tiam2	UTSW	17	3427263	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTAAACTCTCTGGTCCGGTG -3'
(R):5'- TTGGGGAACTGCTAGTCAGC -3'

Sequencing Primer
(F):5'- CTGGTCCGGTGGGTTCCTC -3'
(R):5'- ACACATCTGTATGAATAGCCTCTC -3'

Posted On

2018-02-28