Incidental Mutation 'R6222:Sorcs3'
ID 504113
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Name sortilin-related VPS10 domain containing receptor 3
Synonyms 6330404A12Rik
MMRRC Submission 044353-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6222 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 48194464-48793944 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 48748296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 755 (Y755F)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
AlphaFold Q8VI51
Predicted Effect possibly damaging
Transcript: ENSMUST00000078880
AA Change: Y755F

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: Y755F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T C 14: 35,531,923 (GRCm39) *217W probably null Het
Abcc3 A G 11: 94,259,431 (GRCm39) F337L probably benign Het
Abcc4 T A 14: 118,767,368 (GRCm39) H903L probably damaging Het
Akap7 T A 10: 25,159,844 (GRCm39) K119* probably null Het
Als2 T C 1: 59,219,284 (GRCm39) D1222G probably benign Het
Ano4 T C 10: 88,863,084 (GRCm39) Y296C probably damaging Het
Arid1b A G 17: 5,377,922 (GRCm39) probably null Het
Arl10 T C 13: 54,726,644 (GRCm39) F141L probably damaging Het
B130006D01Rik T C 11: 95,616,988 (GRCm39) probably benign Het
Bbs9 T A 9: 22,479,147 (GRCm39) S197T possibly damaging Het
Bicd1 A T 6: 149,414,463 (GRCm39) D392V probably damaging Het
Bmi1 T A 2: 18,688,513 (GRCm39) M168K possibly damaging Het
C7 A T 15: 5,041,423 (GRCm39) D494E possibly damaging Het
Cacna1s A T 1: 136,032,360 (GRCm39) N1221I probably benign Het
Cacng7 A G 7: 3,385,128 (GRCm39) T10A probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdpf1 T C 15: 85,691,643 (GRCm39) R108G possibly damaging Het
Ceacam5 A T 7: 17,479,472 (GRCm39) K196N probably benign Het
Cftr A C 6: 18,282,500 (GRCm39) T1067P probably benign Het
Cma2 T C 14: 56,210,649 (GRCm39) I112T possibly damaging Het
Cntnap4 A G 8: 113,569,353 (GRCm39) S916G probably damaging Het
Cwf19l2 T A 9: 3,454,569 (GRCm39) Y627* probably null Het
Fam204a A G 19: 60,188,400 (GRCm39) probably null Het
Galnt1 T A 18: 24,397,591 (GRCm39) probably null Het
Gbe1 T C 16: 70,325,900 (GRCm39) probably null Het
Gm6871 C T 7: 41,196,006 (GRCm39) D244N probably damaging Het
Gna15 T C 10: 81,347,880 (GRCm39) T189A probably damaging Het
Igsf10 C T 3: 59,226,336 (GRCm39) D2446N possibly damaging Het
Ing2 T C 8: 48,121,966 (GRCm39) K194R possibly damaging Het
Ino80d G A 1: 63,097,684 (GRCm39) H737Y probably damaging Het
Izumo4 C T 10: 80,538,885 (GRCm39) R83W probably damaging Het
Kcnt1 G A 2: 25,782,522 (GRCm39) V219M probably damaging Het
Kiz A T 2: 146,732,981 (GRCm39) S386C probably damaging Het
Ldlrap1 C T 4: 134,484,671 (GRCm39) E108K probably damaging Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Or2ad1 T C 13: 21,327,047 (GRCm39) Y60C probably damaging Het
Or4c100 T C 2: 88,329,614 (GRCm39) Y62H probably benign Het
Pdzd2 T C 15: 12,374,652 (GRCm39) K1828E probably damaging Het
Prl3a1 T C 13: 27,460,097 (GRCm39) F194L probably benign Het
Prss1l A T 6: 41,374,100 (GRCm39) Y234F probably damaging Het
Reg1 A T 6: 78,404,357 (GRCm39) Q77L probably benign Het
Ruvbl2 G T 7: 45,074,149 (GRCm39) D248E probably damaging Het
Sart3 C T 5: 113,881,267 (GRCm39) A938T probably benign Het
Serpinb5 T A 1: 106,798,070 (GRCm39) C20S probably benign Het
Sh2d4b A C 14: 40,542,694 (GRCm39) S361A probably damaging Het
Snx2 T A 18: 53,332,896 (GRCm39) L190* probably null Het
Styxl2 G T 1: 165,926,214 (GRCm39) Q1133K probably benign Het
Tiam2 A G 17: 3,503,613 (GRCm39) Q930R probably damaging Het
Tll1 C A 8: 64,551,568 (GRCm39) G271V probably benign Het
Tmem116 C T 5: 121,629,171 (GRCm39) T188M probably benign Het
Tmem181a T C 17: 6,351,192 (GRCm39) V367A probably benign Het
Umodl1 T C 17: 31,221,866 (GRCm39) probably null Het
Virma C T 4: 11,527,820 (GRCm39) A1187V probably damaging Het
Wdr53 T C 16: 32,075,482 (GRCm39) V229A probably benign Het
Zcchc10 T C 11: 53,223,289 (GRCm39) probably benign Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48,672,097 (GRCm39) critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48,736,758 (GRCm39) missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48,592,303 (GRCm39) missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48,755,542 (GRCm39) missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48,784,814 (GRCm39) missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48,778,570 (GRCm39) missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48,782,607 (GRCm39) missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48,523,970 (GRCm39) missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48,642,511 (GRCm39) missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48,692,809 (GRCm39) splice site probably benign
IGL02830:Sorcs3 APN 19 48,711,441 (GRCm39) splice site probably null
IGL02943:Sorcs3 APN 19 48,748,377 (GRCm39) missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48,592,333 (GRCm39) missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48,642,483 (GRCm39) missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48,736,758 (GRCm39) missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48,785,956 (GRCm39) critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48,791,137 (GRCm39) nonsense probably null
R0646:Sorcs3 UTSW 19 48,194,734 (GRCm39) missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48,475,845 (GRCm39) missense probably benign
R0792:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48,682,433 (GRCm39) missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48,475,833 (GRCm39) missense probably benign
R1253:Sorcs3 UTSW 19 48,195,175 (GRCm39) missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48,682,440 (GRCm39) critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48,694,448 (GRCm39) missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48,752,620 (GRCm39) missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48,736,798 (GRCm39) critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48,592,314 (GRCm39) missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48,782,713 (GRCm39) missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48,387,150 (GRCm39) missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48,592,343 (GRCm39) missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48,711,395 (GRCm39) missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48,701,943 (GRCm39) missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48,737,812 (GRCm39) missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48,682,353 (GRCm39) missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48,672,036 (GRCm39) missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48,782,602 (GRCm39) missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48,387,183 (GRCm39) missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48,752,587 (GRCm39) missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48,748,390 (GRCm39) missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48,748,284 (GRCm39) critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48,784,911 (GRCm39) splice site probably null
R5848:Sorcs3 UTSW 19 48,776,950 (GRCm39) missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48,737,835 (GRCm39) missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48,784,889 (GRCm39) missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48,387,136 (GRCm39) missense possibly damaging 0.94
R6268:Sorcs3 UTSW 19 48,778,605 (GRCm39) missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48,791,198 (GRCm39) missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48,752,746 (GRCm39) critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48,776,944 (GRCm39) missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48,702,010 (GRCm39) missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48,682,263 (GRCm39) missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48,737,782 (GRCm39) missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48,694,402 (GRCm39) missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48,760,705 (GRCm39) missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48,752,734 (GRCm39) missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48,692,808 (GRCm39) splice site probably null
R8433:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48,194,913 (GRCm39) missense possibly damaging 0.53
R8940:Sorcs3 UTSW 19 48,784,908 (GRCm39) critical splice donor site probably null
R8956:Sorcs3 UTSW 19 48,737,810 (GRCm39) nonsense probably null
R9051:Sorcs3 UTSW 19 48,194,809 (GRCm39) missense probably benign
R9119:Sorcs3 UTSW 19 48,642,433 (GRCm39) missense possibly damaging 0.92
R9166:Sorcs3 UTSW 19 48,784,811 (GRCm39) missense probably benign 0.01
R9328:Sorcs3 UTSW 19 48,785,950 (GRCm39) missense probably damaging 1.00
R9489:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9605:Sorcs3 UTSW 19 48,711,364 (GRCm39) missense probably damaging 1.00
R9757:Sorcs3 UTSW 19 48,711,363 (GRCm39) missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48,760,728 (GRCm39) missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48,634,243 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48,692,739 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGCCATTGTGCCCATC -3'
(R):5'- CGTTTCATCATTGTGAATGGACAAC -3'

Sequencing Primer
(F):5'- TGAGACCATTTCTAAAAGTGTACTG -3'
(R):5'- GTAGCTTTGACCAAGGCT -3'
Posted On 2018-02-28