Incidental Mutation 'R6223:Mgat5'
ID504117
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Namemannoside acetylglucosaminyltransferase 5
Synonyms4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location127205015-127488336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127382979 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 210 (D210V)
Ref Sequence ENSEMBL: ENSMUSP00000129166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038361
AA Change: D210V

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: D210V

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171405
AA Change: D210V

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: D210V

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190921
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127387467 missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127384806 missense probably benign
IGL01795:Mgat5 APN 1 127469231 missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127412132 missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127397550 missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127382985 missense probably benign 0.00
IGL02621:Mgat5 APN 1 127397589 missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127412131 missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127412223 missense probably damaging 1.00
R0518:Mgat5 UTSW 1 127384847 missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127412248 missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127459979 missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127397641 critical splice donor site probably null
R1712:Mgat5 UTSW 1 127320638 missense probably benign 0.34
R1744:Mgat5 UTSW 1 127479469 missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127459969 missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127459959 missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127397607 missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127469250 missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127446299 missense probably benign 0.00
R2566:Mgat5 UTSW 1 127307004 missense probably benign 0.01
R3498:Mgat5 UTSW 1 127384834 missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127366443 missense probably benign
R4674:Mgat5 UTSW 1 127390758 missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127469249 missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127459912 missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127387514 critical splice donor site probably null
R5337:Mgat5 UTSW 1 127459921 missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127397566 missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127387392 missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127382939 missense probably benign 0.10
R6042:Mgat5 UTSW 1 127459899 missense probably damaging 1.00
R6492:Mgat5 UTSW 1 127471564 missense probably benign 0.36
R6662:Mgat5 UTSW 1 127469237 missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127320634 missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127390851 missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127382979 missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127365189 missense probably benign
R7142:Mgat5 UTSW 1 127412187 missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127446262 missense probably damaging 0.97
R7506:Mgat5 UTSW 1 127366455 missense probably benign 0.24
R7790:Mgat5 UTSW 1 127412204 missense probably benign 0.23
R7980:Mgat5 UTSW 1 127479511 missense probably benign 0.13
R8548:Mgat5 UTSW 1 127320672 missense possibly damaging 0.77
X0028:Mgat5 UTSW 1 127366485 missense possibly damaging 0.91
Z1177:Mgat5 UTSW 1 127482692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACATCTGGCAGGAGTTTGG -3'
(R):5'- GCCCCATTCATTAGGGACCTTC -3'

Sequencing Primer
(F):5'- ATCTGGCAGGAGTTTGGTTCCTATC -3'
(R):5'- TAGGGACCTTCAGAGAATTGCTC -3'
Posted On2018-02-28