Incidental Mutation 'R6223:Crat'
ID504119
Institutional Source Beutler Lab
Gene Symbol Crat
Ensembl Gene ENSMUSG00000026853
Gene Namecarnitine acetyltransferase
SynonymsCARAT
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location30400471-30415813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30407030 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 304 (V304I)
Ref Sequence ENSEMBL: ENSMUSP00000099919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000102854] [ENSMUST00000102855] [ENSMUST00000132981] [ENSMUST00000154595] [ENSMUST00000156702]
Predicted Effect probably benign
Transcript: ENSMUST00000028207
AA Change: V304I

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853
AA Change: V304I

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102854
AA Change: V283I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099918
Gene: ENSMUSG00000026853
AA Change: V283I

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 13 595 1.8e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102855
AA Change: V304I

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853
AA Change: V304I

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132981
SMART Domains Protein: ENSMUSP00000118507
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 76 2.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146603
Predicted Effect probably benign
Transcript: ENSMUST00000154595
SMART Domains Protein: ENSMUSP00000114925
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 132 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155790
SMART Domains Protein: ENSMUSP00000122814
Gene: ENSMUSG00000026853

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 133 2.4e-51 PFAM
Pfam:Carn_acyltransf 128 190 8.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156702
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes carnitine O-acetyltransferase, a member of the carnitine acyltransferase family and a key metabolic pathway enzyme which plays an important role in energy homeostasis and fat metabolism. This enzyme catalyzes the reversible transfer of acyl groups from an acyl-CoA thioester to carnitine and regulates the ratio of acyl-CoA/CoA. It is found in both the mitochondria and the peroxisome. Alternative splicing results in transcript variants encoding different isoforms that may localize to different subcellular compartments. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice with muscle specific loss of function display increased circulating glucose level, impaired glucose tolerance, insulin resistance, decreased circulating triglyceride and free fatty acid levels, increased susceptibility to diet-induced obesity and abnormal mitochondrial physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Crat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Crat APN 2 30405187 missense probably damaging 0.99
IGL01357:Crat APN 2 30407724 missense probably damaging 1.00
IGL01538:Crat APN 2 30409966 missense probably damaging 1.00
IGL01973:Crat APN 2 30405481 missense probably damaging 0.98
IGL02228:Crat APN 2 30413182 missense probably damaging 1.00
IGL02408:Crat APN 2 30407134 missense probably damaging 1.00
IGL02569:Crat APN 2 30404530 missense probably damaging 0.99
IGL02637:Crat APN 2 30406389 missense probably benign 0.06
IGL02983:Crat APN 2 30404526 critical splice donor site probably null
IGL03395:Crat APN 2 30404966 missense probably benign 0.11
Charlie UTSW 2 30403541 missense probably damaging 1.00
veruca UTSW 2 30403628 unclassified probably benign
R0136:Crat UTSW 2 30407030 missense probably benign
R0389:Crat UTSW 2 30403628 unclassified probably benign
R0443:Crat UTSW 2 30403628 unclassified probably benign
R0619:Crat UTSW 2 30409984 missense probably benign 0.14
R1938:Crat UTSW 2 30413061 missense probably benign
R1990:Crat UTSW 2 30405048 missense possibly damaging 0.93
R2113:Crat UTSW 2 30402642 missense probably benign 0.00
R2655:Crat UTSW 2 30402691 missense probably damaging 1.00
R3150:Crat UTSW 2 30413859 critical splice donor site probably null
R4231:Crat UTSW 2 30413011 missense possibly damaging 0.95
R4553:Crat UTSW 2 30408217 missense probably benign 0.00
R4592:Crat UTSW 2 30415366 utr 5 prime probably benign
R4718:Crat UTSW 2 30408164 nonsense probably null
R4808:Crat UTSW 2 30410021 missense probably benign 0.01
R4982:Crat UTSW 2 30407136 critical splice acceptor site probably null
R5473:Crat UTSW 2 30407714 missense probably damaging 1.00
R6049:Crat UTSW 2 30403541 missense probably damaging 1.00
R6774:Crat UTSW 2 30413183 missense probably damaging 1.00
R6885:Crat UTSW 2 30415196 splice site probably benign
R7376:Crat UTSW 2 30406465 missense probably damaging 1.00
R7407:Crat UTSW 2 30404565 missense probably benign 0.01
R7408:Crat UTSW 2 30404565 missense probably benign 0.01
R7410:Crat UTSW 2 30404565 missense probably benign 0.01
R7467:Crat UTSW 2 30409982 missense probably damaging 1.00
R7484:Crat UTSW 2 30404565 missense probably benign 0.01
R7514:Crat UTSW 2 30404565 missense probably benign 0.01
R7582:Crat UTSW 2 30404565 missense probably benign 0.01
R7584:Crat UTSW 2 30404565 missense probably benign 0.01
R7585:Crat UTSW 2 30404565 missense probably benign 0.01
R7620:Crat UTSW 2 30408078 missense probably damaging 0.99
R7685:Crat UTSW 2 30404565 missense probably benign 0.01
R7686:Crat UTSW 2 30404565 missense probably benign 0.01
R8332:Crat UTSW 2 30405072 missense possibly damaging 0.71
R8554:Crat UTSW 2 30410023 missense probably benign 0.36
R8766:Crat UTSW 2 30407063 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TTTACAAACAGGAGGCTGGG -3'
(R):5'- TTCTGCACATTCCCTGAAGG -3'

Sequencing Primer
(F):5'- GGACGCTGGGCCTAAGTTG -3'
(R):5'- TTCCCTGAAGGCCCCAAAGATG -3'
Posted On2018-02-28