Mutagenetix > Incidental Mutations

Incidental Mutation 'R6223:Ifih1'

504120

Institutional Source

Beutler Lab

Gene Symbol

Ifih1

Ensembl Gene

ENSMUSG00000026896

Gene Name

interferon induced with helicase C domain 1

Synonyms

MDA5, Helicard, 9130009C22Rik, MDA-5

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62595798-62646255 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62598259 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 891 (I891V)

Ref Sequence

ENSEMBL: ENSMUSP00000108078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028259] [ENSMUST00000112459]

Predicted Effect

probably benign
Transcript: ENSMUST00000028259
AA Change: I940V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028259
Gene: ENSMUSG00000026896
AA Change: I940V

Domain	Start	End	E-Value	Type
Pfam:CARD_2	7	99	3e-22	PFAM
Pfam:CARD_2	110	200	6.8e-22	PFAM
Pfam:CARD	115	200	2.6e-15	PFAM
low complexity region	248	261	N/A	INTRINSIC
DEXDc	305	520	1.08e-26	SMART
Blast:DEXDc	590	712	1e-45	BLAST
HELICc	742	826	1.27e-14	SMART
Pfam:RIG-I_C-RD	903	1018	4.2e-42	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112459
AA Change: I891V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108078
Gene: ENSMUSG00000026896
AA Change: I891V

Domain	Start	End	E-Value	Type
SCOP:d3ygsp_	6	88	1e-3	SMART
Pfam:CARD	115	200	3.9e-15	PFAM
DEXDc	256	471	1.08e-26	SMART
Blast:DEXDc	541	663	1e-45	BLAST
HELICc	693	777	1.27e-14	SMART
Pfam:RIG-I_C-RD	852	973	1.5e-43	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele have increased virus-associated morbidity and mortality, and decreased cytokine response to several viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Ap3b2	G	A	7: 81,473,462	R435*	probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Clspn	T	A	4: 126,586,168	D1101E	probably damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Ggcx	T	C	6: 72,429,605	F684L	probably damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Gtf3c1	C	T	7: 125,676,625	R543K	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prdm2	T	C	4: 143,142,207	N179S	probably benign	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Prx	T	G	7: 27,516,836	M393R	probably damaging	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tex10	T	C	4: 48,468,525	R134G	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Ifih1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00792:Ifih1	APN	2	62645870	missense	probably damaging	1.00
IGL00832:Ifih1	APN	2	62645470	splice site	probably benign
IGL00906:Ifih1	APN	2	62645824	missense	probably benign
IGL01664:Ifih1	APN	2	62611700	splice site	probably benign
IGL01820:Ifih1	APN	2	62617313	missense	probably damaging	1.00
IGL02016:Ifih1	APN	2	62606984	missense	probably benign	0.01
IGL02298:Ifih1	APN	2	62610439	critical splice donor site	probably null
IGL02311:Ifih1	APN	2	62610503	missense	probably damaging	1.00
IGL02635:Ifih1	APN	2	62611829	missense	probably damaging	1.00
Washington	UTSW	2	62598799	missense	possibly damaging	0.88
R0514:Ifih1	UTSW	2	62623391	critical splice donor site	probably null
R1329:Ifih1	UTSW	2	62617487	splice site	probably null
R1484:Ifih1	UTSW	2	62610558	missense	probably benign	0.00
R1769:Ifih1	UTSW	2	62606394	missense	probably damaging	1.00
R2104:Ifih1	UTSW	2	62610545	nonsense	probably null
R2125:Ifih1	UTSW	2	62623467	missense	probably benign	0.43
R2126:Ifih1	UTSW	2	62623467	missense	probably benign	0.43
R2406:Ifih1	UTSW	2	62607103	splice site	probably benign
R3919:Ifih1	UTSW	2	62623501	splice site	probably benign
R4033:Ifih1	UTSW	2	62635190	missense	probably benign
R4060:Ifih1	UTSW	2	62598799	missense	possibly damaging	0.88
R4435:Ifih1	UTSW	2	62645890	missense	probably damaging	1.00
R4538:Ifih1	UTSW	2	62617412	missense	probably damaging	1.00
R4663:Ifih1	UTSW	2	62609219	missense	probably benign	0.00
R4703:Ifih1	UTSW	2	62598876	missense	probably benign	0.05
R4897:Ifih1	UTSW	2	62635014	intron	probably benign
R5274:Ifih1	UTSW	2	62611718	missense	probably benign	0.00
R5949:Ifih1	UTSW	2	62610560	missense	probably benign	0.05
R6140:Ifih1	UTSW	2	62601460	missense	possibly damaging	0.77
R6332:Ifih1	UTSW	2	62639483	missense	possibly damaging	0.64
R6650:Ifih1	UTSW	2	62606447	missense	possibly damaging	0.69
R6813:Ifih1	UTSW	2	62645693	missense	possibly damaging	0.90
R6977:Ifih1	UTSW	2	62606186	missense	probably damaging	1.00
R7054:Ifih1	UTSW	2	62610515	missense	probably benign	0.30
R7167:Ifih1	UTSW	2	62598896	missense	probably benign
R7269:Ifih1	UTSW	2	62645633	missense	probably benign	0.00
R7397:Ifih1	UTSW	2	62623488	missense	possibly damaging	0.85
R7885:Ifih1	UTSW	2	62601469	missense	possibly damaging	0.96
R8672:Ifih1	UTSW	2	62605649	missense	possibly damaging	0.82
Z1176:Ifih1	UTSW	2	62617469	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCACCATCATTGTTCCCCAAG -3'
(R):5'- AGACCAAGAGACAATGTGACATTTG -3'

Sequencing Primer
(F):5'- ATCATTGTTCCCCAAGCCTAG -3'
(R):5'- TGACATATATGTTTAGGATGGGGAC -3'

Posted On

2018-02-28