Incidental Mutation 'R6223:Ifih1'
ID504120
Institutional Source Beutler Lab
Gene Symbol Ifih1
Ensembl Gene ENSMUSG00000026896
Gene Nameinterferon induced with helicase C domain 1
SynonymsMDA5, Helicard, 9130009C22Rik, MDA-5
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location62595798-62646255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62598259 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 891 (I891V)
Ref Sequence ENSEMBL: ENSMUSP00000108078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028259] [ENSMUST00000112459]
Predicted Effect probably benign
Transcript: ENSMUST00000028259
AA Change: I940V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028259
Gene: ENSMUSG00000026896
AA Change: I940V

DomainStartEndE-ValueType
Pfam:CARD_2 7 99 3e-22 PFAM
Pfam:CARD_2 110 200 6.8e-22 PFAM
Pfam:CARD 115 200 2.6e-15 PFAM
low complexity region 248 261 N/A INTRINSIC
DEXDc 305 520 1.08e-26 SMART
Blast:DEXDc 590 712 1e-45 BLAST
HELICc 742 826 1.27e-14 SMART
Pfam:RIG-I_C-RD 903 1018 4.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112459
AA Change: I891V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108078
Gene: ENSMUSG00000026896
AA Change: I891V

DomainStartEndE-ValueType
SCOP:d3ygsp_ 6 88 1e-3 SMART
Pfam:CARD 115 200 3.9e-15 PFAM
DEXDc 256 471 1.08e-26 SMART
Blast:DEXDc 541 663 1e-45 BLAST
HELICc 693 777 1.27e-14 SMART
Pfam:RIG-I_C-RD 852 973 1.5e-43 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele have increased virus-associated morbidity and mortality, and decreased cytokine response to several viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Ifih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ifih1 APN 2 62645870 missense probably damaging 1.00
IGL00832:Ifih1 APN 2 62645470 splice site probably benign
IGL00906:Ifih1 APN 2 62645824 missense probably benign
IGL01664:Ifih1 APN 2 62611700 splice site probably benign
IGL01820:Ifih1 APN 2 62617313 missense probably damaging 1.00
IGL02016:Ifih1 APN 2 62606984 missense probably benign 0.01
IGL02298:Ifih1 APN 2 62610439 critical splice donor site probably null
IGL02311:Ifih1 APN 2 62610503 missense probably damaging 1.00
IGL02635:Ifih1 APN 2 62611829 missense probably damaging 1.00
Washington UTSW 2 62598799 missense possibly damaging 0.88
R0514:Ifih1 UTSW 2 62623391 critical splice donor site probably null
R1329:Ifih1 UTSW 2 62617487 splice site probably null
R1484:Ifih1 UTSW 2 62610558 missense probably benign 0.00
R1769:Ifih1 UTSW 2 62606394 missense probably damaging 1.00
R2104:Ifih1 UTSW 2 62610545 nonsense probably null
R2125:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2126:Ifih1 UTSW 2 62623467 missense probably benign 0.43
R2406:Ifih1 UTSW 2 62607103 splice site probably benign
R3919:Ifih1 UTSW 2 62623501 splice site probably benign
R4033:Ifih1 UTSW 2 62635190 missense probably benign
R4060:Ifih1 UTSW 2 62598799 missense possibly damaging 0.88
R4435:Ifih1 UTSW 2 62645890 missense probably damaging 1.00
R4538:Ifih1 UTSW 2 62617412 missense probably damaging 1.00
R4663:Ifih1 UTSW 2 62609219 missense probably benign 0.00
R4703:Ifih1 UTSW 2 62598876 missense probably benign 0.05
R4897:Ifih1 UTSW 2 62635014 intron probably benign
R5274:Ifih1 UTSW 2 62611718 missense probably benign 0.00
R5949:Ifih1 UTSW 2 62610560 missense probably benign 0.05
R6140:Ifih1 UTSW 2 62601460 missense possibly damaging 0.77
R6332:Ifih1 UTSW 2 62639483 missense possibly damaging 0.64
R6650:Ifih1 UTSW 2 62606447 missense possibly damaging 0.69
R6813:Ifih1 UTSW 2 62645693 missense possibly damaging 0.90
R6977:Ifih1 UTSW 2 62606186 missense probably damaging 1.00
R7054:Ifih1 UTSW 2 62610515 missense probably benign 0.30
R7167:Ifih1 UTSW 2 62598896 missense probably benign
R7269:Ifih1 UTSW 2 62645633 missense probably benign 0.00
R7397:Ifih1 UTSW 2 62623488 missense possibly damaging 0.85
R7885:Ifih1 UTSW 2 62601469 missense possibly damaging 0.96
R8672:Ifih1 UTSW 2 62605649 missense possibly damaging 0.82
Z1176:Ifih1 UTSW 2 62617469 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACCATCATTGTTCCCCAAG -3'
(R):5'- AGACCAAGAGACAATGTGACATTTG -3'

Sequencing Primer
(F):5'- ATCATTGTTCCCCAAGCCTAG -3'
(R):5'- TGACATATATGTTTAGGATGGGGAC -3'
Posted On2018-02-28