Incidental Mutation 'R6223:Sirpb1a'
ID 504127
Institutional Source Beutler Lab
Gene Symbol Sirpb1a
Ensembl Gene ENSMUSG00000095788
Gene Name signal-regulatory protein beta 1A
Synonyms 9930027N05Rik, Sirpb1
MMRRC Submission 044354-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R6223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 15436887-15491487 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 15444086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 388 (V388A)
Ref Sequence ENSEMBL: ENSMUSP00000096807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099201] [ENSMUST00000192700]
AlphaFold A0A0A6YYP6
Predicted Effect probably benign
Transcript: ENSMUST00000099201
AA Change: V388A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096807
Gene: ENSMUSG00000095788
AA Change: V388A

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192700
AA Change: V382A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141504
Gene: ENSMUSG00000095788
AA Change: V382A

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
IG 37 143 2.48e-8 SMART
IGc1 163 236 1.17e-4 SMART
IGc1 269 339 4.91e-4 SMART
transmembrane domain 364 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,269,873 (GRCm39) R8S probably benign Het
Abca8b A G 11: 109,868,672 (GRCm39) V164A probably benign Het
Acadm C A 3: 153,644,186 (GRCm39) probably null Het
Ap3b2 G A 7: 81,123,210 (GRCm39) R435* probably null Het
Art2b A G 7: 101,229,158 (GRCm39) F247S possibly damaging Het
C1rb T A 6: 124,551,539 (GRCm39) D216E probably benign Het
Casz1 C A 4: 149,017,840 (GRCm39) D90E probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdc25a C A 9: 109,718,842 (GRCm39) P409T possibly damaging Het
Cidea A C 18: 67,491,809 (GRCm39) K23T possibly damaging Het
Clspn T A 4: 126,479,961 (GRCm39) D1101E probably damaging Het
Col10a1 A T 10: 34,271,183 (GRCm39) D385V probably damaging Het
Crat C T 2: 30,297,042 (GRCm39) V304I probably benign Het
Cyp2d26 A T 15: 82,675,918 (GRCm39) W265R probably benign Het
Dock8 A T 19: 25,138,416 (GRCm39) Y1247F probably benign Het
Dync2i1 T C 12: 116,221,078 (GRCm39) D11G possibly damaging Het
Eed A G 7: 89,605,495 (GRCm39) Y365H probably damaging Het
Fabp5 T A 3: 10,080,170 (GRCm39) F73L probably benign Het
Fbn1 C T 2: 125,254,591 (GRCm39) C224Y possibly damaging Het
Ggcx T C 6: 72,406,588 (GRCm39) F684L probably damaging Het
Glrp1 G A 1: 88,431,164 (GRCm39) Q69* probably null Het
Gm29797 T C 2: 181,300,850 (GRCm39) V115A possibly damaging Het
Gtf3c1 C T 7: 125,275,797 (GRCm39) R543K probably benign Het
Ifih1 T C 2: 62,428,603 (GRCm39) I891V probably benign Het
Ifnar2 C T 16: 91,184,876 (GRCm39) T89M probably damaging Het
Kat6a C A 8: 23,430,442 (GRCm39) N1932K unknown Het
Mgat5 A T 1: 127,310,716 (GRCm39) D210V possibly damaging Het
Mmel1 A G 4: 154,956,159 (GRCm39) probably null Het
Myh3 G T 11: 66,988,843 (GRCm39) V1499L probably benign Het
Ncan A C 8: 70,562,604 (GRCm39) D551E probably benign Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Olfml3 G A 3: 103,643,776 (GRCm39) R202W probably damaging Het
Or2w4 G A 13: 21,795,536 (GRCm39) T201I probably benign Het
Or4e2 A G 14: 52,688,136 (GRCm39) R89G probably benign Het
Pcdh9 T C 14: 93,253,169 (GRCm39) K1131E probably benign Het
Pcolce A G 5: 137,603,561 (GRCm39) M424T probably damaging Het
Pi16 C A 17: 29,546,413 (GRCm39) S397* probably null Het
Pi4ka A T 16: 17,175,435 (GRCm39) Y464* probably null Het
Pik3c2b T A 1: 132,998,095 (GRCm39) L324M probably damaging Het
Prdm2 T C 4: 142,868,777 (GRCm39) N179S probably benign Het
Prss56 C T 1: 87,113,134 (GRCm39) P183S probably benign Het
Prx T G 7: 27,216,261 (GRCm39) M393R probably damaging Het
Qpctl T C 7: 18,877,134 (GRCm39) D328G probably damaging Het
Qser1 A G 2: 104,617,993 (GRCm39) S940P probably benign Het
Rchy1 G A 5: 92,105,826 (GRCm39) R41W probably damaging Het
Scp2d1 T C 2: 144,665,868 (GRCm39) I69T possibly damaging Het
Ssu2 G T 6: 112,353,409 (GRCm39) C238* probably null Het
Stub1 C T 17: 26,051,787 (GRCm39) G14D probably damaging Het
Tab1 T A 15: 80,032,464 (GRCm39) C24S probably damaging Het
Tdrd1 T C 19: 56,854,282 (GRCm39) V1076A probably damaging Het
Tex10 T C 4: 48,468,525 (GRCm39) R134G probably damaging Het
Tg T A 15: 66,579,771 (GRCm39) N1525K probably benign Het
Tll2 G A 19: 41,124,391 (GRCm39) T208I possibly damaging Het
Tmem232 T C 17: 65,807,191 (GRCm39) M1V probably null Het
Ttc7b A G 12: 100,353,368 (GRCm39) probably null Het
Ubb A G 11: 62,443,351 (GRCm39) E127G possibly damaging Het
Ulk2 A T 11: 61,678,330 (GRCm39) Y796* probably null Het
Vdac2 G A 14: 21,895,246 (GRCm39) G265R possibly damaging Het
Vmn2r45 A T 7: 8,486,301 (GRCm39) V329E probably benign Het
Zbtb47 G A 9: 121,592,853 (GRCm39) R391Q possibly damaging Het
Other mutations in Sirpb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Sirpb1a APN 3 15,475,788 (GRCm39) unclassified probably benign
IGL00597:Sirpb1a APN 3 15,481,977 (GRCm39) missense probably damaging 1.00
IGL01521:Sirpb1a APN 3 15,475,561 (GRCm39) missense probably benign 0.00
IGL01678:Sirpb1a APN 3 15,476,370 (GRCm39) missense probably damaging 1.00
IGL02154:Sirpb1a APN 3 15,475,504 (GRCm39) missense probably damaging 1.00
IGL02275:Sirpb1a APN 3 15,475,469 (GRCm39) critical splice donor site probably null
IGL02419:Sirpb1a APN 3 15,491,398 (GRCm39) missense probably benign
IGL02657:Sirpb1a APN 3 15,482,111 (GRCm39) missense possibly damaging 0.85
IGL03086:Sirpb1a APN 3 15,491,388 (GRCm39) splice site probably null
PIT4142001:Sirpb1a UTSW 3 15,476,258 (GRCm39) missense probably benign 0.00
R0270:Sirpb1a UTSW 3 15,475,587 (GRCm39) missense probably damaging 1.00
R1975:Sirpb1a UTSW 3 15,444,141 (GRCm39) missense probably benign 0.00
R3432:Sirpb1a UTSW 3 15,491,447 (GRCm39) missense probably damaging 0.98
R4613:Sirpb1a UTSW 3 15,482,097 (GRCm39) missense probably benign 0.09
R5325:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R6526:Sirpb1a UTSW 3 15,444,080 (GRCm39) missense probably damaging 0.99
R6903:Sirpb1a UTSW 3 15,481,984 (GRCm39) missense probably damaging 0.99
R7349:Sirpb1a UTSW 3 15,475,664 (GRCm39) missense probably damaging 0.99
R7513:Sirpb1a UTSW 3 15,476,503 (GRCm39) missense possibly damaging 0.90
R8250:Sirpb1a UTSW 3 15,444,104 (GRCm39) missense possibly damaging 0.92
R8700:Sirpb1a UTSW 3 15,476,419 (GRCm39) missense probably damaging 0.97
R9263:Sirpb1a UTSW 3 15,481,992 (GRCm39) missense probably damaging 1.00
R9553:Sirpb1a UTSW 3 15,476,320 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCCCATGTTACTCCATTGAG -3'
(R):5'- TTGTAGGGATCAGGAGTCAACC -3'

Sequencing Primer
(F):5'- CCATTGAGTAACATCCATCTGGTG -3'
(R):5'- CCAATGGGTCAAGTATAGACCAATG -3'
Posted On 2018-02-28