Incidental Mutation 'R6223:Acadm'
ID504129
Institutional Source Beutler Lab
Gene Symbol Acadm
Ensembl Gene ENSMUSG00000062908
Gene Nameacyl-Coenzyme A dehydrogenase, medium chain
SynonymsMCAD
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location153922357-153944632 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to A at 153938549 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072697] [ENSMUST00000150070] [ENSMUST00000156310]
Predicted Effect probably null
Transcript: ENSMUST00000072697
SMART Domains Protein: ENSMUSP00000072483
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 42 152 2e-27 PFAM
Pfam:Acyl-CoA_dh_M 157 255 2.3e-26 PFAM
Pfam:Acyl-CoA_dh_1 267 416 1.7e-48 PFAM
Pfam:Acyl-CoA_dh_2 283 405 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137161
Predicted Effect probably null
Transcript: ENSMUST00000150070
SMART Domains Protein: ENSMUSP00000121714
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_N 36 121 5.4e-21 PFAM
Pfam:Acyl-CoA_dh_M 125 144 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156310
SMART Domains Protein: ENSMUSP00000122989
Gene: ENSMUSG00000062908

DomainStartEndE-ValueType
PDB:2A1T|D 1 77 2e-30 PDB
SCOP:d3mdda2 36 88 2e-9 SMART
low complexity region 101 111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200250
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a homotetrameric mitochondrial flavoprotein and is a member of the acyl-CoA dehydrogenase family. Members of this family catalyze the first step of fatty acid beta-oxidation, forming a C2-C3 trans-double bond in a FAD-dependent reaction. As beta-oxidation cycles through its four steps, each member of the acyl-CoA dehydrogenase family works at an optimum fatty acid chain-length. This enzyme has its optimum length between C6- and C12-acylCoA. In mice, deficiency of this gene can cause neonatal mortality as well as fasting and cold intolerance. This gene has multiple, intronless pseudogenes. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display a high degree of postnatal lethality, develop an organic aciduria, fatty liver and an unexpected diffuse cardiomyopathy with multifocal myocyte degeneration and necrosis, and show severe cold intolerance with prior fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Acadm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02452:Acadm APN 3 153941970 missense probably damaging 1.00
IGL02598:Acadm APN 3 153938544 splice site probably benign
IGL02642:Acadm APN 3 153939083 missense probably damaging 1.00
R0092:Acadm UTSW 3 153941875 splice site probably benign
R0270:Acadm UTSW 3 153936324 missense possibly damaging 0.89
R1543:Acadm UTSW 3 153929572 missense probably damaging 1.00
R1868:Acadm UTSW 3 153930252 missense probably benign 0.03
R1955:Acadm UTSW 3 153929551 missense probably damaging 0.97
R2281:Acadm UTSW 3 153933043 missense possibly damaging 0.75
R3774:Acadm UTSW 3 153933097 missense probably benign
R4768:Acadm UTSW 3 153922942 missense probably benign 0.00
R4994:Acadm UTSW 3 153929584 missense probably damaging 1.00
R5194:Acadm UTSW 3 153933118 missense possibly damaging 0.63
R5523:Acadm UTSW 3 153938636 missense probably benign 0.13
R5927:Acadm UTSW 3 153939108 missense probably damaging 1.00
R6109:Acadm UTSW 3 153941943 missense probably damaging 1.00
R6896:Acadm UTSW 3 153936320 missense probably damaging 0.99
R7108:Acadm UTSW 3 153925800 nonsense probably null
R7182:Acadm UTSW 3 153941881 critical splice donor site probably null
R7334:Acadm UTSW 3 153939061 nonsense probably null
R7440:Acadm UTSW 3 153922989 missense probably damaging 1.00
R7882:Acadm UTSW 3 153938613 nonsense probably null
R7965:Acadm UTSW 3 153938613 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCCCAGGTAAGCGATTAG -3'
(R):5'- CCCTGTCTAGATGGTTTCGAG -3'

Sequencing Primer
(F):5'- GCACACATGTATGTCTATGTATGTG -3'
(R):5'- CTGTCTAGATGGTTTCGAGTTTATTG -3'
Posted On2018-02-28