Mutagenetix > Incidental Mutations

Incidental Mutation 'R6223:Tex10'

504130

Institutional Source

Beutler Lab

Gene Symbol

Tex10

Ensembl Gene

ENSMUSG00000028345

Gene Name

testis expressed gene 10

Synonyms

clone 18330, 2810462N03Rik, 2610206N19Rik

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48430858-48473459 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48468525 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 134 (R134G)

Ref Sequence

ENSEMBL: ENSMUSP00000114669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030030] [ENSMUST00000155905] [ENSMUST00000164866]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030030
AA Change: R217G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030030
Gene: ENSMUSG00000028345
AA Change: R217G

Domain	Start	End	E-Value	Type
low complexity region	13	25	N/A	INTRINSIC
Pfam:Ipi1_N	130	235	9.7e-24	PFAM
low complexity region	832	846	N/A	INTRINSIC
low complexity region	856	873	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132911

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155750

Predicted Effect

probably damaging
Transcript: ENSMUST00000155905
AA Change: R134G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114669
Gene: ENSMUSG00000028345
AA Change: R134G

Domain	Start	End	E-Value	Type
Pfam:Ipi1_N	47	152	3.4e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164866
AA Change: R217G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132498
Gene: ENSMUSG00000028345
AA Change: R217G

Domain	Start	End	E-Value	Type
low complexity region	13	25	N/A	INTRINSIC
Pfam:Ipi1_N	132	235	4.1e-25	PFAM
low complexity region	832	846	N/A	INTRINSIC
low complexity region	856	873	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E7.5 with impaired inner cell mass proliferation in culture. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Ap3b2	G	A	7: 81,473,462	R435*	probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Clspn	T	A	4: 126,586,168	D1101E	probably damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Ggcx	T	C	6: 72,429,605	F684L	probably damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Gtf3c1	C	T	7: 125,676,625	R543K	probably benign	Het
Ifih1	T	C	2: 62,598,259	I891V	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prdm2	T	C	4: 143,142,207	N179S	probably benign	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Prx	T	G	7: 27,516,836	M393R	probably damaging	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Tex10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Tex10	APN	4	48469937	nonsense	probably null
IGL00832:Tex10	APN	4	48468864	missense	probably benign
IGL01376:Tex10	APN	4	48456740	missense	possibly damaging	0.90
IGL01594:Tex10	APN	4	48469906	missense	possibly damaging	0.47
IGL02754:Tex10	APN	4	48435028	missense	possibly damaging	0.46
IGL03071:Tex10	APN	4	48452946	missense	probably benign	0.00
IGL03399:Tex10	APN	4	48459915	missense	probably benign	0.04
R0105:Tex10	UTSW	4	48468957	missense	probably damaging	0.99
R0105:Tex10	UTSW	4	48468957	missense	probably damaging	0.99
R0544:Tex10	UTSW	4	48462766	splice site	probably null
R0583:Tex10	UTSW	4	48451952	missense	probably damaging	1.00
R0591:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R0592:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R0593:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R0893:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R1485:Tex10	UTSW	4	48436492	missense	possibly damaging	0.54
R1703:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R1704:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R1706:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R1911:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R1912:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R1930:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R1983:Tex10	UTSW	4	48460059	missense	possibly damaging	0.93
R2001:Tex10	UTSW	4	48451940	missense	probably damaging	1.00
R2074:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R2075:Tex10	UTSW	4	48456800	missense	probably benign	0.04
R2157:Tex10	UTSW	4	48436522	splice site	probably benign
R3000:Tex10	UTSW	4	48459393	splice site	probably null
R4067:Tex10	UTSW	4	48459355	nonsense	probably null
R4081:Tex10	UTSW	4	48468873	missense	probably benign	0.11
R4133:Tex10	UTSW	4	48468968	missense	probably damaging	1.00
R4352:Tex10	UTSW	4	48452039	missense	possibly damaging	0.77
R4364:Tex10	UTSW	4	48468774	missense	probably benign	0.13
R4601:Tex10	UTSW	4	48452946	missense	probably benign	0.00
R4602:Tex10	UTSW	4	48452946	missense	probably benign	0.00
R4610:Tex10	UTSW	4	48452946	missense	probably benign	0.00
R4707:Tex10	UTSW	4	48468984	missense	probably benign	0.00
R4744:Tex10	UTSW	4	48469990	missense	probably benign	0.00
R4778:Tex10	UTSW	4	48436468	missense	probably damaging	1.00
R4989:Tex10	UTSW	4	48458525	splice site	probably benign
R5051:Tex10	UTSW	4	48460019	missense	possibly damaging	0.86
R5120:Tex10	UTSW	4	48459272	missense	possibly damaging	0.68
R5732:Tex10	UTSW	4	48460046	missense	probably damaging	1.00
R5799:Tex10	UTSW	4	48433295	missense	possibly damaging	0.62
R5813:Tex10	UTSW	4	48452928	missense	probably benign	0.00
R6091:Tex10	UTSW	4	48459891	missense	probably damaging	0.98
R6493:Tex10	UTSW	4	48436450	missense	probably damaging	1.00
R7567:Tex10	UTSW	4	48468787	missense	possibly damaging	0.93
R7590:Tex10	UTSW	4	48467725	missense	probably damaging	0.99
R7808:Tex10	UTSW	4	48459984	missense	probably benign
R8004:Tex10	UTSW	4	48452047	missense	possibly damaging	0.64
R8084:Tex10	UTSW	4	48431066	missense	probably benign	0.05
X0017:Tex10	UTSW	4	48460080	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCGTTGGCATGATCCTTCCAG -3'
(R):5'- AAGTGCCCATCTCTCTAGTGC -3'

Sequencing Primer
(F):5'- GTTGATAAAAATGGAGTTGCTAGTGG -3'
(R):5'- GTGCCATGACTCACATTACTGAAGG -3'

Posted On

2018-02-28