Incidental Mutation 'R6223:Clspn'
ID504131
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Nameclaspin
SynonymsC85083, E130314M08Rik
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location126556935-126593903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126586168 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1101 (D1101E)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391]
Predicted Effect probably damaging
Transcript: ENSMUST00000048391
AA Change: D1101E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: D1101E

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128202
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126573178 missense probably damaging 1.00
IGL02160:Clspn APN 4 126581510 missense probably benign 0.21
IGL02231:Clspn APN 4 126559228 missense probably damaging 0.98
IGL02281:Clspn APN 4 126565770 missense possibly damaging 0.90
IGL02368:Clspn APN 4 126566107 missense probably benign
IGL03149:Clspn APN 4 126576502 splice site probably benign
Durch UTSW 4 126580962 missense probably damaging 0.99
R0012:Clspn UTSW 4 126564929 unclassified probably benign
R0035:Clspn UTSW 4 126565003 splice site probably null
R0035:Clspn UTSW 4 126565003 splice site probably null
R0207:Clspn UTSW 4 126590598 missense possibly damaging 0.82
R0270:Clspn UTSW 4 126573236 missense probably damaging 1.00
R0825:Clspn UTSW 4 126573130 splice site probably benign
R1082:Clspn UTSW 4 126577779 missense possibly damaging 0.95
R1349:Clspn UTSW 4 126563977 missense probably benign
R1568:Clspn UTSW 4 126581517 missense probably benign 0.01
R1649:Clspn UTSW 4 126566435 unclassified probably benign
R1663:Clspn UTSW 4 126565975 missense probably benign 0.00
R2497:Clspn UTSW 4 126572347 missense possibly damaging 0.79
R3107:Clspn UTSW 4 126591659 missense probably benign 0.06
R3951:Clspn UTSW 4 126576379 missense probably damaging 1.00
R3953:Clspn UTSW 4 126566437 frame shift probably null
R3954:Clspn UTSW 4 126566437 frame shift probably null
R3956:Clspn UTSW 4 126566437 frame shift probably null
R4599:Clspn UTSW 4 126581460 missense probably benign 0.14
R4717:Clspn UTSW 4 126560056 missense probably damaging 1.00
R4853:Clspn UTSW 4 126566555 missense probably damaging 0.99
R4854:Clspn UTSW 4 126575950 missense probably benign
R4979:Clspn UTSW 4 126578386 missense probably damaging 1.00
R5363:Clspn UTSW 4 126561786 missense possibly damaging 0.58
R5531:Clspn UTSW 4 126577773 missense probably benign
R5614:Clspn UTSW 4 126580962 missense probably damaging 0.99
R5706:Clspn UTSW 4 126578418 missense probably damaging 1.00
R5806:Clspn UTSW 4 126586106 missense probably damaging 1.00
R6106:Clspn UTSW 4 126590641 missense probably benign 0.00
R6178:Clspn UTSW 4 126577736 splice site probably null
R6326:Clspn UTSW 4 126565739 missense probably damaging 1.00
R6398:Clspn UTSW 4 126563947 missense probably damaging 1.00
R6714:Clspn UTSW 4 126565768 missense probably damaging 1.00
R7003:Clspn UTSW 4 126592720 missense possibly damaging 0.63
R7034:Clspn UTSW 4 126580982 missense possibly damaging 0.87
R7358:Clspn UTSW 4 126566200 missense probably benign 0.02
R7376:Clspn UTSW 4 126590637 missense possibly damaging 0.65
R7675:Clspn UTSW 4 126566320 missense probably benign 0.00
R8320:Clspn UTSW 4 126563950 missense possibly damaging 0.73
R8517:Clspn UTSW 4 126566219 missense probably benign 0.00
R8547:Clspn UTSW 4 126561816 missense probably damaging 1.00
T0975:Clspn UTSW 4 126566437 unclassified probably benign
X0014:Clspn UTSW 4 126575943 missense probably damaging 1.00
Z1177:Clspn UTSW 4 126566177 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCGTCTGATGAGGAGCTG -3'
(R):5'- GAACTCAGAGCATCTGTTTCTAGG -3'

Sequencing Primer
(F):5'- TCTGATGAGGAGCTGGAGAGTC -3'
(R):5'- CAGAGCATCTGTTTCTAGGCAAGC -3'
Posted On2018-02-28