Mutagenetix > Incidental Mutations

Incidental Mutation 'R6223:Clspn'

504131

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 126586168 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1101 (D1101E)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048391
AA Change: D1101E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: D1101E

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121439

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128202

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Ap3b2	G	A	7: 81,473,462	R435*	probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Ggcx	T	C	6: 72,429,605	F684L	probably damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Gtf3c1	C	T	7: 125,676,625	R543K	probably benign	Het
Ifih1	T	C	2: 62,598,259	I891V	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prdm2	T	C	4: 143,142,207	N179S	probably benign	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Prx	T	G	7: 27,516,836	M393R	probably damaging	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tex10	T	C	4: 48,468,525	R134G	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCCGTCTGATGAGGAGCTG -3'
(R):5'- GAACTCAGAGCATCTGTTTCTAGG -3'

Sequencing Primer
(F):5'- TCTGATGAGGAGCTGGAGAGTC -3'
(R):5'- CAGAGCATCTGTTTCTAGGCAAGC -3'

Posted On

2018-02-28