Mutagenetix > Incidental Mutation

Incidental Mutation 'R6223:Prdm2'

504132

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143142207 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 179 (N179S)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

probably benign
Transcript: ENSMUST00000105778
AA Change: N179S

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: N179S

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Ap3b2	G	A	7: 81,473,462	R435*	probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Clspn	T	A	4: 126,586,168	D1101E	probably damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Ggcx	T	C	6: 72,429,605	F684L	probably damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Gtf3c1	C	T	7: 125,676,625	R543K	probably benign	Het
Ifih1	T	C	2: 62,598,259	I891V	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Prx	T	G	7: 27,516,836	M393R	probably damaging	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tex10	T	C	4: 48,468,525	R134G	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
R9518:Prdm2	UTSW	4	143134009	missense	possibly damaging	0.94
R9546:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9547:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGAGAATACTTTCATTCTGAAGAGG -3'
(R):5'- TGCAGGACCTACGAGCTTTG -3'

Sequencing Primer
(F):5'- CTTTCATTCTGAAGAGGAAGTAGGG -3'
(R):5'- CAGTCTACTTTGCTTGGG -3'

Posted On

2018-02-28