Incidental Mutation 'R6223:Mmel1'
ID504134
Institutional Source Beutler Lab
Gene Symbol Mmel1
Ensembl Gene ENSMUSG00000058183
Gene Namemembrane metallo-endopeptidase-like 1
SynonymsNep2, Mell1, Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154869585-154895528 bp(+) (GRCm38)
Type of Mutationsplice site (4577 bp from exon)
DNA Base Change (assembly) A to G at 154871702 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050220] [ENSMUST00000079269] [ENSMUST00000080559] [ENSMUST00000105634] [ENSMUST00000105635] [ENSMUST00000163732] [ENSMUST00000207854]
Predicted Effect probably null
Transcript: ENSMUST00000050220
SMART Domains Protein: ENSMUSP00000051782
Gene: ENSMUSG00000046637

DomainStartEndE-ValueType
Blast:TPR 38 68 4e-6 BLAST
low complexity region 69 85 N/A INTRINSIC
TPR 166 199 2.66e0 SMART
TPR 200 233 4.45e-2 SMART
TPR 294 327 9e1 SMART
Blast:TPR 328 361 2e-7 BLAST
TPR 412 445 8.77e1 SMART
TPR 452 485 1.78e-1 SMART
Blast:TPR 500 533 9e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000079269
AA Change: E17G

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078252
Gene: ENSMUSG00000058183
AA Change: E17G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 767 1.2e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080559
AA Change: E17G

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079399
Gene: ENSMUSG00000058183
AA Change: E17G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 4.8e-131 PFAM
Pfam:Peptidase_M13 573 779 3.4e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105634
AA Change: E17G

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101259
Gene: ENSMUSG00000058183
AA Change: E17G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 512 1.4e-105 PFAM
Pfam:Peptidase_M13 573 781 4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105635
AA Change: E17G

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101260
Gene: ENSMUSG00000058183
AA Change: E17G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 76 475 1.6e-135 PFAM
Pfam:Peptidase_M13 536 744 1.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151696
Predicted Effect possibly damaging
Transcript: ENSMUST00000163732
AA Change: E17G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131753
Gene: ENSMUSG00000058183
AA Change: E17G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Peptidase_M13_N 99 498 1.7e-135 PFAM
Pfam:Peptidase_M13 559 765 3.3e-71 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207854
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the neutral endopeptidase (NEP) or membrane metallo-endopeptidase (MME) family. Family members play important roles in pain perception, arterial pressure regulation, phosphate metabolism and homeostasis. This protein is a type II transmembrane protein and is thought to be expressed as a secreted protein. This gene is expressed mainly in testis with weak expression in the brain, kidney, and heart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display impaired male fertility. Female fertility is not affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Mmel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Mmel1 APN 4 154887832 splice site probably benign
IGL01560:Mmel1 APN 4 154892510 missense probably null 1.00
IGL01734:Mmel1 APN 4 154891951 missense probably benign 0.00
IGL02933:Mmel1 APN 4 154883630 missense probably damaging 1.00
IGL03178:Mmel1 APN 4 154890854 missense possibly damaging 0.75
R1161:Mmel1 UTSW 4 154895214 missense probably damaging 1.00
R1522:Mmel1 UTSW 4 154894986 missense probably damaging 1.00
R1566:Mmel1 UTSW 4 154883653 missense probably damaging 1.00
R1885:Mmel1 UTSW 4 154890876 missense possibly damaging 0.76
R2177:Mmel1 UTSW 4 154894103 missense probably damaging 1.00
R3413:Mmel1 UTSW 4 154889586 missense probably damaging 1.00
R3432:Mmel1 UTSW 4 154885498 splice site probably benign
R3870:Mmel1 UTSW 4 154883638 missense probably benign 0.01
R4197:Mmel1 UTSW 4 154893304 missense probably damaging 1.00
R4822:Mmel1 UTSW 4 154887897 missense probably benign 0.00
R4998:Mmel1 UTSW 4 154885510 missense probably benign 0.00
R5135:Mmel1 UTSW 4 154882324 missense probably benign 0.20
R5225:Mmel1 UTSW 4 154891999 missense probably damaging 0.96
R5821:Mmel1 UTSW 4 154885587 missense possibly damaging 0.82
R6131:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6132:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6133:Mmel1 UTSW 4 154895018 missense probably damaging 1.00
R6194:Mmel1 UTSW 4 154883216 nonsense probably null
R6786:Mmel1 UTSW 4 154892428 nonsense probably null
R6921:Mmel1 UTSW 4 154881677 missense probably damaging 0.97
R7272:Mmel1 UTSW 4 154894090 missense probably damaging 1.00
R7373:Mmel1 UTSW 4 154889208 missense not run
R7685:Mmel1 UTSW 4 154871654 start codon destroyed probably null 0.28
R7996:Mmel1 UTSW 4 154892455 missense probably benign 0.03
R8683:Mmel1 UTSW 4 154889528 missense probably benign 0.13
R8856:Mmel1 UTSW 4 154885021 missense possibly damaging 0.84
X0025:Mmel1 UTSW 4 154894685 missense probably benign 0.06
Z1176:Mmel1 UTSW 4 154895208 nonsense probably null
Z1177:Mmel1 UTSW 4 154894074 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGTGTCCTAGGCATCCGATC -3'
(R):5'- GACAGAGCTTTCTGGATGGG -3'

Sequencing Primer
(F):5'- ATCCGGGCTCCAGCTGC -3'
(R):5'- ACCTCTGGAGTCAGCAGTGTG -3'
Posted On2018-02-28