Mutagenetix > Incidental Mutations

Incidental Mutation 'R6223:Ggcx'

504137

Institutional Source

Beutler Lab

Gene Symbol

Ggcx

Ensembl Gene

ENSMUSG00000053460

Gene Name

gamma-glutamyl carboxylase

Synonyms

vitamin K-dependent carboxylase

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

72414308-72430712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72429605 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 684 (F684L)

Ref Sequence

ENSEMBL: ENSMUSP00000070109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059472] [ENSMUST00000065906] [ENSMUST00000205335] [ENSMUST00000205738] [ENSMUST00000205823] [ENSMUST00000206692]

Predicted Effect

probably benign
Transcript: ENSMUST00000059472

SMART Domains

Protein: ENSMUSP00000087118
Gene: ENSMUSG00000053907

Domain	Start	End	E-Value	Type
Pfam:S-AdoMet_synt_N	17	115	1.7e-45	PFAM
Pfam:S-AdoMet_synt_M	129	250	2.4e-47	PFAM
Pfam:S-AdoMet_synt_C	252	389	1.5e-68	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000065906
AA Change: F684L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: F684L

Domain	Start	End	E-Value	Type
HTTM	56	315	1.34e-131	SMART
low complexity region	368	377	N/A	INTRINSIC
low complexity region	630	645	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205335

Predicted Effect

probably benign
Transcript: ENSMUST00000205738

Predicted Effect

probably benign
Transcript: ENSMUST00000205823

Predicted Effect

probably benign
Transcript: ENSMUST00000206692

Predicted Effect

probably benign
Transcript: ENSMUST00000206904

Predicted Effect

probably benign
Transcript: ENSMUST00000207000

Predicted Effect

probably benign
Transcript: ENSMUST00000207012

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Ap3b2	G	A	7: 81,473,462	R435*	probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Clspn	T	A	4: 126,586,168	D1101E	probably damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Gtf3c1	C	T	7: 125,676,625	R543K	probably benign	Het
Ifih1	T	C	2: 62,598,259	I891V	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prdm2	T	C	4: 143,142,207	N179S	probably benign	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Prx	T	G	7: 27,516,836	M393R	probably damaging	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tex10	T	C	4: 48,468,525	R134G	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Ggcx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01657:Ggcx	APN	6	72429958	splice site	probably null
IGL02373:Ggcx	APN	6	72427919	missense	probably damaging	1.00
IGL02589:Ggcx	APN	6	72429148	missense	probably damaging	1.00
IGL02634:Ggcx	APN	6	72418303	missense	probably damaging	1.00
IGL02661:Ggcx	APN	6	72418360	missense	possibly damaging	0.78
IGL02701:Ggcx	APN	6	72418472	intron	probably benign
R0503:Ggcx	UTSW	6	72429157	frame shift	probably null
R1034:Ggcx	UTSW	6	72414831	missense	probably damaging	1.00
R2219:Ggcx	UTSW	6	72427982	missense	probably benign	0.29
R3892:Ggcx	UTSW	6	72418372	missense	probably damaging	0.99
R3951:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R3952:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R4320:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4321:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4322:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4324:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4782:Ggcx	UTSW	6	72428892	missense	probably benign	0.01
R5370:Ggcx	UTSW	6	72425931	missense	possibly damaging	0.69
R5523:Ggcx	UTSW	6	72424034	missense	probably damaging	1.00
R5902:Ggcx	UTSW	6	72429996	missense	possibly damaging	0.92
R6126:Ggcx	UTSW	6	72417983	missense	possibly damaging	0.57
R6199:Ggcx	UTSW	6	72430139	missense	possibly damaging	0.57
R6515:Ggcx	UTSW	6	72425832	missense	probably benign	0.33
R7205:Ggcx	UTSW	6	72428004	missense	probably damaging	1.00
R7923:Ggcx	UTSW	6	72427917	missense	probably damaging	1.00
R8034:Ggcx	UTSW	6	72428604	missense	possibly damaging	0.47
R8096:Ggcx	UTSW	6	72429993	missense	probably benign	0.33
R8116:Ggcx	UTSW	6	72429528	missense	possibly damaging	0.66
R8356:Ggcx	UTSW	6	72429591	missense	probably benign	0.03
Z1177:Ggcx	UTSW	6	72426519	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TCTTCTGGACAGAAACAGGGC -3'
(R):5'- ATGCAAGCAGACCCTACTCTG -3'

Sequencing Primer
(F):5'- CCCCTGCCTCCAGAACTTCAG -3'
(R):5'- GCAGACCCTACTCTGAAGCTTG -3'

Posted On

2018-02-28