Incidental Mutation 'R6223:Ggcx'
ID 504137
Institutional Source Beutler Lab
Gene Symbol Ggcx
Ensembl Gene ENSMUSG00000053460
Gene Name gamma-glutamyl carboxylase
Synonyms vitamin K-dependent carboxylase
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R6223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 72414308-72430712 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72429605 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 684 (F684L)
Ref Sequence ENSEMBL: ENSMUSP00000070109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059472] [ENSMUST00000065906] [ENSMUST00000205335] [ENSMUST00000205738] [ENSMUST00000205823] [ENSMUST00000206692]
AlphaFold Q9QYC7
Predicted Effect probably benign
Transcript: ENSMUST00000059472
SMART Domains Protein: ENSMUSP00000087118
Gene: ENSMUSG00000053907

DomainStartEndE-ValueType
Pfam:S-AdoMet_synt_N 17 115 1.7e-45 PFAM
Pfam:S-AdoMet_synt_M 129 250 2.4e-47 PFAM
Pfam:S-AdoMet_synt_C 252 389 1.5e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065906
AA Change: F684L

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: F684L

DomainStartEndE-ValueType
HTTM 56 315 1.34e-131 SMART
low complexity region 368 377 N/A INTRINSIC
low complexity region 630 645 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205335
Predicted Effect probably benign
Transcript: ENSMUST00000205738
Predicted Effect probably benign
Transcript: ENSMUST00000205823
Predicted Effect probably benign
Transcript: ENSMUST00000206692
Predicted Effect probably benign
Transcript: ENSMUST00000206904
Predicted Effect probably benign
Transcript: ENSMUST00000207000
Predicted Effect probably benign
Transcript: ENSMUST00000207012
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Ggcx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01657:Ggcx APN 6 72429958 splice site probably null
IGL02373:Ggcx APN 6 72427919 missense probably damaging 1.00
IGL02589:Ggcx APN 6 72429148 missense probably damaging 1.00
IGL02634:Ggcx APN 6 72418303 missense probably damaging 1.00
IGL02661:Ggcx APN 6 72418360 missense possibly damaging 0.78
IGL02701:Ggcx APN 6 72418472 intron probably benign
R0503:Ggcx UTSW 6 72429157 frame shift probably null
R1034:Ggcx UTSW 6 72414831 missense probably damaging 1.00
R2219:Ggcx UTSW 6 72427982 missense probably benign 0.29
R3892:Ggcx UTSW 6 72418372 missense probably damaging 0.99
R3951:Ggcx UTSW 6 72426558 missense probably benign 0.01
R3952:Ggcx UTSW 6 72426558 missense probably benign 0.01
R4320:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4321:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4322:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4324:Ggcx UTSW 6 72428820 missense probably benign 0.24
R4782:Ggcx UTSW 6 72428892 missense probably benign 0.01
R5370:Ggcx UTSW 6 72425931 missense possibly damaging 0.69
R5523:Ggcx UTSW 6 72424034 missense probably damaging 1.00
R5902:Ggcx UTSW 6 72429996 missense possibly damaging 0.92
R6126:Ggcx UTSW 6 72417983 missense possibly damaging 0.57
R6199:Ggcx UTSW 6 72430139 missense possibly damaging 0.57
R6515:Ggcx UTSW 6 72425832 missense probably benign 0.33
R7205:Ggcx UTSW 6 72428004 missense probably damaging 1.00
R7923:Ggcx UTSW 6 72427917 missense probably damaging 1.00
R8034:Ggcx UTSW 6 72428604 missense possibly damaging 0.47
R8096:Ggcx UTSW 6 72429993 missense probably benign 0.33
R8116:Ggcx UTSW 6 72429528 missense possibly damaging 0.66
R8356:Ggcx UTSW 6 72429591 missense probably benign 0.03
R8977:Ggcx UTSW 6 72429282 critical splice donor site probably null
R9074:Ggcx UTSW 6 72425941 missense probably damaging 1.00
R9145:Ggcx UTSW 6 72425922 missense probably benign 0.18
R9285:Ggcx UTSW 6 72418419 nonsense probably null
R9362:Ggcx UTSW 6 72428032 missense probably damaging 1.00
R9497:Ggcx UTSW 6 72429207 missense probably damaging 1.00
Z1177:Ggcx UTSW 6 72426519 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTTCTGGACAGAAACAGGGC -3'
(R):5'- ATGCAAGCAGACCCTACTCTG -3'

Sequencing Primer
(F):5'- CCCCTGCCTCCAGAACTTCAG -3'
(R):5'- GCAGACCCTACTCTGAAGCTTG -3'
Posted On 2018-02-28