Incidental Mutation 'R6223:Ap3b2'
ID 504143
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 044354-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R6223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 81123210 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 435 (R435*)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably null
Transcript: ENSMUST00000082090
AA Change: R435*
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: R435*

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125634
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,269,873 (GRCm39) R8S probably benign Het
Abca8b A G 11: 109,868,672 (GRCm39) V164A probably benign Het
Acadm C A 3: 153,644,186 (GRCm39) probably null Het
Art2b A G 7: 101,229,158 (GRCm39) F247S possibly damaging Het
C1rb T A 6: 124,551,539 (GRCm39) D216E probably benign Het
Casz1 C A 4: 149,017,840 (GRCm39) D90E probably damaging Het
Ccdc13 A G 9: 121,627,975 (GRCm39) probably benign Het
Cdc25a C A 9: 109,718,842 (GRCm39) P409T possibly damaging Het
Cidea A C 18: 67,491,809 (GRCm39) K23T possibly damaging Het
Clspn T A 4: 126,479,961 (GRCm39) D1101E probably damaging Het
Col10a1 A T 10: 34,271,183 (GRCm39) D385V probably damaging Het
Crat C T 2: 30,297,042 (GRCm39) V304I probably benign Het
Cyp2d26 A T 15: 82,675,918 (GRCm39) W265R probably benign Het
Dock8 A T 19: 25,138,416 (GRCm39) Y1247F probably benign Het
Dync2i1 T C 12: 116,221,078 (GRCm39) D11G possibly damaging Het
Eed A G 7: 89,605,495 (GRCm39) Y365H probably damaging Het
Fabp5 T A 3: 10,080,170 (GRCm39) F73L probably benign Het
Fbn1 C T 2: 125,254,591 (GRCm39) C224Y possibly damaging Het
Ggcx T C 6: 72,406,588 (GRCm39) F684L probably damaging Het
Glrp1 G A 1: 88,431,164 (GRCm39) Q69* probably null Het
Gm29797 T C 2: 181,300,850 (GRCm39) V115A possibly damaging Het
Gtf3c1 C T 7: 125,275,797 (GRCm39) R543K probably benign Het
Ifih1 T C 2: 62,428,603 (GRCm39) I891V probably benign Het
Ifnar2 C T 16: 91,184,876 (GRCm39) T89M probably damaging Het
Kat6a C A 8: 23,430,442 (GRCm39) N1932K unknown Het
Mgat5 A T 1: 127,310,716 (GRCm39) D210V possibly damaging Het
Mmel1 A G 4: 154,956,159 (GRCm39) probably null Het
Myh3 G T 11: 66,988,843 (GRCm39) V1499L probably benign Het
Ncan A C 8: 70,562,604 (GRCm39) D551E probably benign Het
Nol11 G T 11: 107,062,442 (GRCm39) T598K possibly damaging Het
Olfml3 G A 3: 103,643,776 (GRCm39) R202W probably damaging Het
Or2w4 G A 13: 21,795,536 (GRCm39) T201I probably benign Het
Or4e2 A G 14: 52,688,136 (GRCm39) R89G probably benign Het
Pcdh9 T C 14: 93,253,169 (GRCm39) K1131E probably benign Het
Pcolce A G 5: 137,603,561 (GRCm39) M424T probably damaging Het
Pi16 C A 17: 29,546,413 (GRCm39) S397* probably null Het
Pi4ka A T 16: 17,175,435 (GRCm39) Y464* probably null Het
Pik3c2b T A 1: 132,998,095 (GRCm39) L324M probably damaging Het
Prdm2 T C 4: 142,868,777 (GRCm39) N179S probably benign Het
Prss56 C T 1: 87,113,134 (GRCm39) P183S probably benign Het
Prx T G 7: 27,216,261 (GRCm39) M393R probably damaging Het
Qpctl T C 7: 18,877,134 (GRCm39) D328G probably damaging Het
Qser1 A G 2: 104,617,993 (GRCm39) S940P probably benign Het
Rchy1 G A 5: 92,105,826 (GRCm39) R41W probably damaging Het
Scp2d1 T C 2: 144,665,868 (GRCm39) I69T possibly damaging Het
Sirpb1a A G 3: 15,444,086 (GRCm39) V388A probably benign Het
Ssu2 G T 6: 112,353,409 (GRCm39) C238* probably null Het
Stub1 C T 17: 26,051,787 (GRCm39) G14D probably damaging Het
Tab1 T A 15: 80,032,464 (GRCm39) C24S probably damaging Het
Tdrd1 T C 19: 56,854,282 (GRCm39) V1076A probably damaging Het
Tex10 T C 4: 48,468,525 (GRCm39) R134G probably damaging Het
Tg T A 15: 66,579,771 (GRCm39) N1525K probably benign Het
Tll2 G A 19: 41,124,391 (GRCm39) T208I possibly damaging Het
Tmem232 T C 17: 65,807,191 (GRCm39) M1V probably null Het
Ttc7b A G 12: 100,353,368 (GRCm39) probably null Het
Ubb A G 11: 62,443,351 (GRCm39) E127G possibly damaging Het
Ulk2 A T 11: 61,678,330 (GRCm39) Y796* probably null Het
Vdac2 G A 14: 21,895,246 (GRCm39) G265R possibly damaging Het
Vmn2r45 A T 7: 8,486,301 (GRCm39) V329E probably benign Het
Zbtb47 G A 9: 121,592,853 (GRCm39) R391Q possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTCAGTTACAGCAATACCTG -3'
(R):5'- GGCATGATGAGTTGTCATACGG -3'

Sequencing Primer
(F):5'- TGCACACTAACTGAAGCAGATAG -3'
(R):5'- ATGATGAGTTGTCATACGGAGGTTTG -3'
Posted On 2018-02-28