Mutagenetix > Incidental Mutations

Incidental Mutation 'R6223:Ap3b2'

504143

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 81473462 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 435 (R435*)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

Predicted Effect

probably null
Transcript: ENSMUST00000082090
AA Change: R435*

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: R435*

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125634

Predicted Effect

probably benign
Transcript: ENSMUST00000152355

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Clspn	T	A	4: 126,586,168	D1101E	probably damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Ggcx	T	C	6: 72,429,605	F684L	probably damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Gtf3c1	C	T	7: 125,676,625	R543K	probably benign	Het
Ifih1	T	C	2: 62,598,259	I891V	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prdm2	T	C	4: 143,142,207	N179S	probably benign	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Prx	T	G	7: 27,516,836	M393R	probably damaging	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tex10	T	C	4: 48,468,525	R134G	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTCAGTTACAGCAATACCTG -3'
(R):5'- GGCATGATGAGTTGTCATACGG -3'

Sequencing Primer
(F):5'- TGCACACTAACTGAAGCAGATAG -3'
(R):5'- ATGATGAGTTGTCATACGGAGGTTTG -3'

Posted On

2018-02-28