Mutagenetix > Incidental Mutation

Incidental Mutation 'R6223:Gtf3c1'

504146

Institutional Source

Beutler Lab

Gene Symbol

Gtf3c1

Ensembl Gene

ENSMUSG00000032777

Gene Name

general transcription factor III C 1

Synonyms

MMRRC Submission

044354-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

125640954-125707780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125676625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 543 (R543K)

Ref Sequence

ENSEMBL: ENSMUSP00000145939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205444] [ENSMUST00000205659]

AlphaFold

Q8K284

Predicted Effect

probably benign
Transcript: ENSMUST00000055506
AA Change: R543K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: R543K

Domain	Start	End	E-Value	Type
Pfam:B-block_TFIIIC	174	250	5.1e-20	PFAM
low complexity region	344	354	N/A	INTRINSIC
low complexity region	474	514	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	592	604	N/A	INTRINSIC
low complexity region	725	745	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
low complexity region	1158	1173	N/A	INTRINSIC
low complexity region	1359	1372	N/A	INTRINSIC
low complexity region	1423	1443	N/A	INTRINSIC
low complexity region	1585	1620	N/A	INTRINSIC
low complexity region	1895	1915	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205444

Predicted Effect

probably benign
Transcript: ENSMUST00000205659
AA Change: R543K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205697

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6820408C15Rik	A	C	2: 152,427,953	R8S	probably benign	Het
Abca8b	A	G	11: 109,977,846	V164A	probably benign	Het
Acadm	C	A	3: 153,938,549		probably null	Het
Ap3b2	G	A	7: 81,473,462	R435*	probably null	Het
Art2b	A	G	7: 101,579,951	F247S	possibly damaging	Het
C1rb	T	A	6: 124,574,580	D216E	probably benign	Het
Casz1	C	A	4: 148,933,383	D90E	probably damaging	Het
Ccdc13	A	G	9: 121,798,909		probably benign	Het
Cdc25a	C	A	9: 109,889,774	P409T	possibly damaging	Het
Cidea	A	C	18: 67,358,739	K23T	possibly damaging	Het
Clspn	T	A	4: 126,586,168	D1101E	probably damaging	Het
Col10a1	A	T	10: 34,395,187	D385V	probably damaging	Het
Crat	C	T	2: 30,407,030	V304I	probably benign	Het
Cyp2d26	A	T	15: 82,791,717	W265R	probably benign	Het
Dock8	A	T	19: 25,161,052	Y1247F	probably benign	Het
Eed	A	G	7: 89,956,287	Y365H	probably damaging	Het
Fabp5	T	A	3: 10,015,110	F73L	probably benign	Het
Fbn1	C	T	2: 125,412,671	C224Y	possibly damaging	Het
Ggcx	T	C	6: 72,429,605	F684L	probably damaging	Het
Glrp1	G	A	1: 88,503,442	Q69*	probably null	Het
Gm29797	T	C	2: 181,659,057	V115A	possibly damaging	Het
Ifih1	T	C	2: 62,598,259	I891V	probably benign	Het
Ifnar2	C	T	16: 91,387,988	T89M	probably damaging	Het
Kat6a	C	A	8: 22,940,426	N1932K	unknown	Het
Mgat5	A	T	1: 127,382,979	D210V	possibly damaging	Het
Mmel1	A	G	4: 154,871,702		probably null	Het
Myh3	G	T	11: 67,098,017	V1499L	probably benign	Het
Ncan	A	C	8: 70,109,954	D551E	probably benign	Het
Nol11	G	T	11: 107,171,616	T598K	possibly damaging	Het
Olfml3	G	A	3: 103,736,460	R202W	probably damaging	Het
Olfr1362	G	A	13: 21,611,366	T201I	probably benign	Het
Olfr1509	A	G	14: 52,450,679	R89G	probably benign	Het
Pcdh9	T	C	14: 93,015,733	K1131E	probably benign	Het
Pcolce	A	G	5: 137,605,299	M424T	probably damaging	Het
Pi16	C	A	17: 29,327,439	S397*	probably null	Het
Pi4ka	A	T	16: 17,357,571	Y464*	probably null	Het
Pik3c2b	T	A	1: 133,070,357	L324M	probably damaging	Het
Prdm2	T	C	4: 143,142,207	N179S	probably benign	Het
Prss56	C	T	1: 87,185,412	P183S	probably benign	Het
Prx	T	G	7: 27,516,836	M393R	probably damaging	Het
Qpctl	T	C	7: 19,143,209	D328G	probably damaging	Het
Qser1	A	G	2: 104,787,648	S940P	probably benign	Het
Rchy1	G	A	5: 91,957,967	R41W	probably damaging	Het
Scp2d1	T	C	2: 144,823,948	I69T	possibly damaging	Het
Sirpb1a	A	G	3: 15,379,026	V388A	probably benign	Het
Ssu2	G	T	6: 112,376,448	C238*	probably null	Het
Stub1	C	T	17: 25,832,813	G14D	probably damaging	Het
Tab1	T	A	15: 80,148,263	C24S	probably damaging	Het
Tdrd1	T	C	19: 56,865,850	V1076A	probably damaging	Het
Tex10	T	C	4: 48,468,525	R134G	probably damaging	Het
Tg	T	A	15: 66,707,922	N1525K	probably benign	Het
Tll2	G	A	19: 41,135,952	T208I	possibly damaging	Het
Tmem232	T	C	17: 65,500,196	M1V	probably null	Het
Ttc7b	A	G	12: 100,387,109		probably null	Het
Ubb	A	G	11: 62,552,525	E127G	possibly damaging	Het
Ulk2	A	T	11: 61,787,504	Y796*	probably null	Het
Vdac2	G	A	14: 21,845,178	G265R	possibly damaging	Het
Vmn2r45	A	T	7: 8,483,302	V329E	probably benign	Het
Wdr60	T	C	12: 116,257,458	D11G	possibly damaging	Het
Zfp651	G	A	9: 121,763,787	R391Q	possibly damaging	Het

Other mutations in Gtf3c1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Gtf3c1	APN	7	125644258	missense	probably benign	0.15
IGL00535:Gtf3c1	APN	7	125644153	missense	probably benign	0.00
IGL00778:Gtf3c1	APN	7	125667374	missense	probably damaging	1.00
IGL00832:Gtf3c1	APN	7	125654460	splice site	probably benign
IGL01383:Gtf3c1	APN	7	125699500	missense	probably damaging	1.00
IGL01472:Gtf3c1	APN	7	125651054	splice site	probably benign
IGL01743:Gtf3c1	APN	7	125663415	missense	probably damaging	1.00
IGL01867:Gtf3c1	APN	7	125662376	missense	probably benign	0.44
IGL02016:Gtf3c1	APN	7	125668039	missense	probably damaging	1.00
IGL02096:Gtf3c1	APN	7	125659112	missense	probably damaging	0.98
IGL02121:Gtf3c1	APN	7	125646731	nonsense	probably null
IGL02226:Gtf3c1	APN	7	125667990	splice site	probably null
IGL02376:Gtf3c1	APN	7	125668996	missense	probably benign	0.41
IGL02581:Gtf3c1	APN	7	125646515	missense	possibly damaging	0.80
IGL02750:Gtf3c1	APN	7	125676512	missense	probably damaging	1.00
IGL03063:Gtf3c1	APN	7	125646503	missense	possibly damaging	0.72
IGL03167:Gtf3c1	APN	7	125670580	critical splice acceptor site	probably null
R0052:Gtf3c1	UTSW	7	125667971	splice site	probably null
R0266:Gtf3c1	UTSW	7	125644134	missense	possibly damaging	0.83
R0378:Gtf3c1	UTSW	7	125647614	nonsense	probably null
R0387:Gtf3c1	UTSW	7	125681104	missense	probably damaging	1.00
R0426:Gtf3c1	UTSW	7	125663016	nonsense	probably null
R0458:Gtf3c1	UTSW	7	125644134	missense	possibly damaging	0.83
R0613:Gtf3c1	UTSW	7	125644134	missense	possibly damaging	0.83
R0634:Gtf3c1	UTSW	7	125657477	unclassified	probably benign
R0658:Gtf3c1	UTSW	7	125698962	missense	probably damaging	1.00
R0904:Gtf3c1	UTSW	7	125668842	splice site	probably benign
R1051:Gtf3c1	UTSW	7	125707649	missense	probably damaging	1.00
R1481:Gtf3c1	UTSW	7	125693138	critical splice donor site	probably null
R1590:Gtf3c1	UTSW	7	125676661	missense	possibly damaging	0.90
R1782:Gtf3c1	UTSW	7	125667074	missense	probably damaging	1.00
R1981:Gtf3c1	UTSW	7	125644272	missense	possibly damaging	0.96
R2513:Gtf3c1	UTSW	7	125681173	missense	probably benign	0.01
R2697:Gtf3c1	UTSW	7	125643954	missense	probably damaging	0.98
R3963:Gtf3c1	UTSW	7	125693225	splice site	probably null
R4125:Gtf3c1	UTSW	7	125647450	nonsense	probably null
R4127:Gtf3c1	UTSW	7	125647450	nonsense	probably null
R4646:Gtf3c1	UTSW	7	125659094	missense	possibly damaging	0.66
R4653:Gtf3c1	UTSW	7	125674100	missense	probably benign	0.23
R4668:Gtf3c1	UTSW	7	125667338	missense	probably damaging	1.00
R4803:Gtf3c1	UTSW	7	125663540	missense	probably damaging	1.00
R5138:Gtf3c1	UTSW	7	125647492	missense	probably benign	0.05
R5149:Gtf3c1	UTSW	7	125668037	missense	probably damaging	0.99
R5286:Gtf3c1	UTSW	7	125663408	missense	possibly damaging	0.79
R5437:Gtf3c1	UTSW	7	125667368	missense	probably damaging	1.00
R5493:Gtf3c1	UTSW	7	125670544	missense	probably damaging	1.00
R5610:Gtf3c1	UTSW	7	125703945	missense	possibly damaging	0.94
R5656:Gtf3c1	UTSW	7	125662654	missense	probably benign	0.27
R5754:Gtf3c1	UTSW	7	125644065	missense	possibly damaging	0.86
R5969:Gtf3c1	UTSW	7	125645676	missense	possibly damaging	0.91
R6009:Gtf3c1	UTSW	7	125647430	missense	possibly damaging	0.66
R6580:Gtf3c1	UTSW	7	125644347	missense	probably benign	0.02
R6628:Gtf3c1	UTSW	7	125668074	missense	probably benign	0.04
R6774:Gtf3c1	UTSW	7	125641621	missense	possibly damaging	0.93
R6781:Gtf3c1	UTSW	7	125659197	nonsense	probably null
R6978:Gtf3c1	UTSW	7	125645534	missense	possibly damaging	0.86
R7078:Gtf3c1	UTSW	7	125645742	missense	possibly damaging	0.95
R7096:Gtf3c1	UTSW	7	125696559	critical splice acceptor site	probably null
R7146:Gtf3c1	UTSW	7	125672821	missense	possibly damaging	0.48
R7246:Gtf3c1	UTSW	7	125669094
R7330:Gtf3c1	UTSW	7	125703883	missense	probably benign	0.36
R7345:Gtf3c1	UTSW	7	125645670	missense	probably damaging	1.00
R7480:Gtf3c1	UTSW	7	125642541	missense	probably benign	0.22
R7490:Gtf3c1	UTSW	7	125647491	missense	probably damaging	0.98
R7555:Gtf3c1	UTSW	7	125645670	missense	probably damaging	1.00
R7895:Gtf3c1	UTSW	7	125672822	missense	possibly damaging	0.94
R7949:Gtf3c1	UTSW	7	125651081	missense	probably benign
R8123:Gtf3c1	UTSW	7	125704024	start gained	probably benign
R8295:Gtf3c1	UTSW	7	125663062	missense	probably benign	0.01
R8421:Gtf3c1	UTSW	7	125698970	missense	probably damaging	1.00
R8438:Gtf3c1	UTSW	7	125642529	nonsense	probably null
R8517:Gtf3c1	UTSW	7	125654551	missense	probably damaging	1.00
R8970:Gtf3c1	UTSW	7	125673055	unclassified	probably benign
R9005:Gtf3c1	UTSW	7	125703897	missense	probably benign	0.25
R9156:Gtf3c1	UTSW	7	125645777	missense	possibly damaging	0.78
R9292:Gtf3c1	UTSW	7	125674391	intron	probably benign
R9400:Gtf3c1	UTSW	7	125676511	missense	probably damaging	0.96
R9658:Gtf3c1	UTSW	7	125707562	missense	probably damaging	1.00
R9660:Gtf3c1	UTSW	7	125663027	missense	possibly damaging	0.52
X0065:Gtf3c1	UTSW	7	125641690	missense	probably damaging	1.00
Z1176:Gtf3c1	UTSW	7	125703964	missense	probably damaging	0.99
Z1177:Gtf3c1	UTSW	7	125667122	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- TTCCTGTCCCTGGATTCGAG -3'
(R):5'- GTTTTGTACTCCAAGACTGTAGAGTG -3'

Sequencing Primer
(F):5'- GTCCCTGGATTCGAGTACTGAAC -3'
(R):5'- TCCAAGACTGTAGAGTGAGCCC -3'

Posted On

2018-02-28