Incidental Mutation 'R6223:Gtf3c1'
ID504146
Institutional Source Beutler Lab
Gene Symbol Gtf3c1
Ensembl Gene ENSMUSG00000032777
Gene Namegeneral transcription factor III C 1
Synonyms
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location125640954-125707780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125676625 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 543 (R543K)
Ref Sequence ENSEMBL: ENSMUSP00000145939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055506] [ENSMUST00000205444] [ENSMUST00000205659]
Predicted Effect probably benign
Transcript: ENSMUST00000055506
AA Change: R543K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000056719
Gene: ENSMUSG00000032777
AA Change: R543K

DomainStartEndE-ValueType
Pfam:B-block_TFIIIC 174 250 5.1e-20 PFAM
low complexity region 344 354 N/A INTRINSIC
low complexity region 474 514 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 592 604 N/A INTRINSIC
low complexity region 725 745 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 1158 1173 N/A INTRINSIC
low complexity region 1359 1372 N/A INTRINSIC
low complexity region 1423 1443 N/A INTRINSIC
low complexity region 1585 1620 N/A INTRINSIC
low complexity region 1895 1915 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205444
Predicted Effect probably benign
Transcript: ENSMUST00000205659
AA Change: R543K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205697
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit preimplantation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Gtf3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Gtf3c1 APN 7 125644258 missense probably benign 0.15
IGL00535:Gtf3c1 APN 7 125644153 missense probably benign 0.00
IGL00778:Gtf3c1 APN 7 125667374 missense probably damaging 1.00
IGL00832:Gtf3c1 APN 7 125654460 splice site probably benign
IGL01383:Gtf3c1 APN 7 125699500 missense probably damaging 1.00
IGL01472:Gtf3c1 APN 7 125651054 splice site probably benign
IGL01743:Gtf3c1 APN 7 125663415 missense probably damaging 1.00
IGL01867:Gtf3c1 APN 7 125662376 missense probably benign 0.44
IGL02016:Gtf3c1 APN 7 125668039 missense probably damaging 1.00
IGL02096:Gtf3c1 APN 7 125659112 missense probably damaging 0.98
IGL02121:Gtf3c1 APN 7 125646731 nonsense probably null
IGL02226:Gtf3c1 APN 7 125667990 splice site probably null
IGL02376:Gtf3c1 APN 7 125668996 missense probably benign 0.41
IGL02581:Gtf3c1 APN 7 125646515 missense possibly damaging 0.80
IGL02750:Gtf3c1 APN 7 125676512 missense probably damaging 1.00
IGL03063:Gtf3c1 APN 7 125646503 missense possibly damaging 0.72
IGL03167:Gtf3c1 APN 7 125670580 critical splice acceptor site probably null
Godiva UTSW 7 125645534 missense possibly damaging 0.86
R0052:Gtf3c1 UTSW 7 125667971 splice site probably null
R0266:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0378:Gtf3c1 UTSW 7 125647614 nonsense probably null
R0387:Gtf3c1 UTSW 7 125681104 missense probably damaging 1.00
R0426:Gtf3c1 UTSW 7 125663016 nonsense probably null
R0458:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0613:Gtf3c1 UTSW 7 125644134 missense possibly damaging 0.83
R0634:Gtf3c1 UTSW 7 125657477 unclassified probably benign
R0658:Gtf3c1 UTSW 7 125698962 missense probably damaging 1.00
R0904:Gtf3c1 UTSW 7 125668842 splice site probably benign
R1051:Gtf3c1 UTSW 7 125707649 missense probably damaging 1.00
R1481:Gtf3c1 UTSW 7 125693138 critical splice donor site probably null
R1590:Gtf3c1 UTSW 7 125676661 missense possibly damaging 0.90
R1782:Gtf3c1 UTSW 7 125667074 missense probably damaging 1.00
R1981:Gtf3c1 UTSW 7 125644272 missense possibly damaging 0.96
R2513:Gtf3c1 UTSW 7 125681173 missense probably benign 0.01
R2697:Gtf3c1 UTSW 7 125643954 missense probably damaging 0.98
R3963:Gtf3c1 UTSW 7 125693225 splice site probably null
R4125:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4127:Gtf3c1 UTSW 7 125647450 nonsense probably null
R4646:Gtf3c1 UTSW 7 125659094 missense possibly damaging 0.66
R4653:Gtf3c1 UTSW 7 125674100 missense probably benign 0.23
R4668:Gtf3c1 UTSW 7 125667338 missense probably damaging 1.00
R4803:Gtf3c1 UTSW 7 125663540 missense probably damaging 1.00
R5138:Gtf3c1 UTSW 7 125647492 missense probably benign 0.05
R5149:Gtf3c1 UTSW 7 125668037 missense probably damaging 0.99
R5286:Gtf3c1 UTSW 7 125663408 missense possibly damaging 0.79
R5437:Gtf3c1 UTSW 7 125667368 missense probably damaging 1.00
R5493:Gtf3c1 UTSW 7 125670544 missense probably damaging 1.00
R5610:Gtf3c1 UTSW 7 125703945 missense possibly damaging 0.94
R5656:Gtf3c1 UTSW 7 125662654 missense probably benign 0.27
R5754:Gtf3c1 UTSW 7 125644065 missense possibly damaging 0.86
R5969:Gtf3c1 UTSW 7 125645676 missense possibly damaging 0.91
R6009:Gtf3c1 UTSW 7 125647430 missense possibly damaging 0.66
R6580:Gtf3c1 UTSW 7 125644347 missense probably benign 0.02
R6628:Gtf3c1 UTSW 7 125668074 missense probably benign 0.04
R6774:Gtf3c1 UTSW 7 125641621 missense possibly damaging 0.93
R6781:Gtf3c1 UTSW 7 125659197 nonsense probably null
R6978:Gtf3c1 UTSW 7 125645534 missense possibly damaging 0.86
R7078:Gtf3c1 UTSW 7 125645742 missense possibly damaging 0.95
R7096:Gtf3c1 UTSW 7 125696559 critical splice acceptor site probably null
R7146:Gtf3c1 UTSW 7 125672821 missense possibly damaging 0.48
R7246:Gtf3c1 UTSW 7 125669094
R7330:Gtf3c1 UTSW 7 125703883 missense probably benign 0.36
R7345:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7480:Gtf3c1 UTSW 7 125642541 missense probably benign 0.22
R7490:Gtf3c1 UTSW 7 125647491 missense probably damaging 0.98
R7555:Gtf3c1 UTSW 7 125645670 missense probably damaging 1.00
R7895:Gtf3c1 UTSW 7 125672822 missense possibly damaging 0.94
R7949:Gtf3c1 UTSW 7 125651081 missense probably benign
R8123:Gtf3c1 UTSW 7 125704024 start gained probably benign
R8295:Gtf3c1 UTSW 7 125663062 missense probably benign 0.01
R8421:Gtf3c1 UTSW 7 125698970 missense probably damaging 1.00
R8438:Gtf3c1 UTSW 7 125642529 nonsense probably null
R8517:Gtf3c1 UTSW 7 125654551 missense probably damaging 1.00
X0065:Gtf3c1 UTSW 7 125641690 missense probably damaging 1.00
Z1176:Gtf3c1 UTSW 7 125703964 missense probably damaging 0.99
Z1177:Gtf3c1 UTSW 7 125667122 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TTCCTGTCCCTGGATTCGAG -3'
(R):5'- GTTTTGTACTCCAAGACTGTAGAGTG -3'

Sequencing Primer
(F):5'- GTCCCTGGATTCGAGTACTGAAC -3'
(R):5'- TCCAAGACTGTAGAGTGAGCCC -3'
Posted On2018-02-28