Incidental Mutation 'R6223:Kat6a'
ID504147
Institutional Source Beutler Lab
Gene Symbol Kat6a
Ensembl Gene ENSMUSG00000031540
Gene NameK(lysine) acetyltransferase 6A
SynonymsZfp220, MOZ, 9930021N24Rik, Myst3
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location22859535-22943259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 22940426 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1932 (N1932K)
Ref Sequence ENSEMBL: ENSMUSP00000106324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044331] [ENSMUST00000110696]
Predicted Effect unknown
Transcript: ENSMUST00000044331
AA Change: N1932K
SMART Domains Protein: ENSMUSP00000038181
Gene: ENSMUSG00000031540
AA Change: N1932K

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 561 748 5.9e-92 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110696
AA Change: N1932K
SMART Domains Protein: ENSMUSP00000106324
Gene: ENSMUSG00000031540
AA Change: N1932K

DomainStartEndE-ValueType
H15 85 165 1.88e-5 SMART
low complexity region 184 195 N/A INTRINSIC
PHD 208 263 1.7e-7 SMART
RING 209 262 1.28e0 SMART
PHD 264 311 9.84e-13 SMART
RING 265 310 4.15e0 SMART
low complexity region 371 378 N/A INTRINSIC
Pfam:MOZ_SAS 564 742 2.9e-85 PFAM
low complexity region 787 800 N/A INTRINSIC
low complexity region 985 1003 N/A INTRINSIC
low complexity region 1011 1029 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
low complexity region 1066 1079 N/A INTRINSIC
low complexity region 1149 1162 N/A INTRINSIC
low complexity region 1224 1238 N/A INTRINSIC
low complexity region 1257 1273 N/A INTRINSIC
coiled coil region 1278 1308 N/A INTRINSIC
low complexity region 1397 1409 N/A INTRINSIC
low complexity region 1471 1490 N/A INTRINSIC
low complexity region 1528 1542 N/A INTRINSIC
low complexity region 1569 1597 N/A INTRINSIC
low complexity region 1641 1700 N/A INTRINSIC
low complexity region 1802 1813 N/A INTRINSIC
low complexity region 1950 1958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the MOZ, YBFR2, SAS2, TIP60 family of histone acetyltransferases. The protein is composed of a nuclear localization domain, a double C2H2 zinc finger domain that binds to acetylated histone tails, a histone acetyl-transferase domain, a glutamate/aspartate-rich region, and a serine- and methionine-rich transactivation domain. It is part of a complex that acetylates lysine-9 residues in histone 3, and in addition, it acts as a co-activator for several transcription factors. Allelic variants of this gene are associated with autosomal dominant mental retardation-32. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice display perinatal lethality, cyanosis, decreased hematopoietic progenitor cell numbers, and severely impaired spleen and thymus development, but are not anemic. Heterozygotes display strain background dependent reductions in fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Kat6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Kat6a APN 8 22940263 missense unknown
IGL01093:Kat6a APN 8 22939321 missense possibly damaging 0.85
IGL01364:Kat6a APN 8 22907700 missense probably damaging 1.00
IGL01868:Kat6a APN 8 22926455 missense probably damaging 1.00
IGL02477:Kat6a APN 8 22929300 missense probably damaging 1.00
IGL02792:Kat6a APN 8 22938300 missense probably damaging 0.98
IGL03243:Kat6a APN 8 22910222 missense possibly damaging 0.77
Anning UTSW 8 22932113 critical splice acceptor site probably null
lord UTSW 8 22862364 missense probably damaging 1.00
master UTSW 8 22862788 missense probably damaging 0.99
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0018:Kat6a UTSW 8 22929273 missense possibly damaging 0.74
R0284:Kat6a UTSW 8 22939803 missense unknown
R0636:Kat6a UTSW 8 22939323 missense possibly damaging 0.73
R0883:Kat6a UTSW 8 22862214 missense probably damaging 1.00
R1457:Kat6a UTSW 8 22938652 missense probably benign
R1753:Kat6a UTSW 8 22935797 missense probably benign 0.09
R2059:Kat6a UTSW 8 22939305 missense possibly damaging 0.53
R2155:Kat6a UTSW 8 22935647 small deletion probably benign
R2764:Kat6a UTSW 8 22932178 missense probably damaging 1.00
R3724:Kat6a UTSW 8 22862788 missense probably damaging 0.99
R3824:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R3825:Kat6a UTSW 8 22862364 missense probably damaging 1.00
R4370:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4371:Kat6a UTSW 8 22911929 missense possibly damaging 0.95
R4457:Kat6a UTSW 8 22932113 critical splice acceptor site probably null
R4600:Kat6a UTSW 8 22939311 missense probably benign 0.18
R4792:Kat6a UTSW 8 22940576 missense unknown
R4896:Kat6a UTSW 8 22938313 missense probably benign 0.07
R5069:Kat6a UTSW 8 22903133 missense probably damaging 1.00
R5192:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5196:Kat6a UTSW 8 22911713 missense probably damaging 0.99
R5279:Kat6a UTSW 8 22939648 small deletion probably benign
R5331:Kat6a UTSW 8 22939984 missense unknown
R5480:Kat6a UTSW 8 22938307 missense possibly damaging 0.77
R5659:Kat6a UTSW 8 22938160 nonsense probably null
R5759:Kat6a UTSW 8 22938012 missense probably benign 0.04
R5787:Kat6a UTSW 8 22932647 missense probably damaging 0.99
R5892:Kat6a UTSW 8 22938289 missense probably damaging 1.00
R5923:Kat6a UTSW 8 22939479 missense probably benign 0.00
R6049:Kat6a UTSW 8 22939037 missense possibly damaging 0.53
R6276:Kat6a UTSW 8 22939405 missense possibly damaging 0.96
R6279:Kat6a UTSW 8 22939612 missense unknown
R6300:Kat6a UTSW 8 22939612 missense unknown
R6307:Kat6a UTSW 8 22940368 missense unknown
R6562:Kat6a UTSW 8 22911787 missense probably benign 0.04
R6807:Kat6a UTSW 8 22940368 missense unknown
R6852:Kat6a UTSW 8 22938660 missense probably benign 0.18
R6875:Kat6a UTSW 8 22932361 missense probably benign 0.02
R6895:Kat6a UTSW 8 22935783 missense possibly damaging 0.88
R6913:Kat6a UTSW 8 22903199 missense possibly damaging 0.53
R7047:Kat6a UTSW 8 22938538 missense possibly damaging 0.53
R7235:Kat6a UTSW 8 22914269 missense possibly damaging 0.94
R7243:Kat6a UTSW 8 22938775 missense probably benign 0.00
R7454:Kat6a UTSW 8 22935772 missense possibly damaging 0.56
R7618:Kat6a UTSW 8 22862562 missense possibly damaging 0.95
R7768:Kat6a UTSW 8 22903212 missense probably damaging 1.00
R7980:Kat6a UTSW 8 22926416 missense possibly damaging 0.95
R8051:Kat6a UTSW 8 22910249 missense probably damaging 0.99
R8408:Kat6a UTSW 8 22862259 missense probably damaging 1.00
R8725:Kat6a UTSW 8 22908277 missense probably damaging 1.00
R8743:Kat6a UTSW 8 22939006 missense possibly damaging 0.85
X0050:Kat6a UTSW 8 22940481 nonsense probably null
Z1088:Kat6a UTSW 8 22935501 nonsense probably null
Z1176:Kat6a UTSW 8 22910154 missense probably damaging 1.00
Z1177:Kat6a UTSW 8 22940166 missense unknown
Z1190:Kat6a UTSW 8 22940229 missense unknown
Predicted Primers PCR Primer
(F):5'- TATCCGTTCCAAGTCTGCAC -3'
(R):5'- GCAGCATTCATGTAGCTGTG -3'

Sequencing Primer
(F):5'- ACAGCAGCTATATGGCCGCAG -3'
(R):5'- CAGCATTCATGTAGCTGTGATGGG -3'
Posted On2018-02-28