Incidental Mutation 'R6223:Cdc25a'
ID504149
Institutional Source Beutler Lab
Gene Symbol Cdc25a
Ensembl Gene ENSMUSG00000032477
Gene Namecell division cycle 25A
SynonymsD9Ertd393e
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109875579-109893895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 109889774 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 409 (P409T)
Ref Sequence ENSEMBL: ENSMUSP00000091882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094324] [ENSMUST00000198308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094324
AA Change: P409T

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091882
Gene: ENSMUSG00000032477
AA Change: P409T

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 85 318 3.6e-69 PFAM
RHOD 356 469 2.6e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198219
Predicted Effect possibly damaging
Transcript: ENSMUST00000198308
AA Change: P348T

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142958
Gene: ENSMUSG00000032477
AA Change: P348T

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 24 258 1.2e-88 PFAM
RHOD 295 408 5.97e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199353
Predicted Effect unknown
Transcript: ENSMUST00000199787
AA Change: P193T
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit elevated levels of early erythroid progenitor cell cycling but erythropoiesis is normally unaffected. Homozygous deletion of this gene is lethal and male heterozygotes display decreased vertebral trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Cdc25a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cdc25a APN 9 109876126 splice site probably null
IGL01761:Cdc25a APN 9 109891865 intron probably benign
IGL02808:Cdc25a APN 9 109883599 splice site probably null
IGL03241:Cdc25a APN 9 109884199 splice site probably null
P4748:Cdc25a UTSW 9 109884108 splice site probably benign
R1472:Cdc25a UTSW 9 109876089 missense probably benign 0.00
R1571:Cdc25a UTSW 9 109881546 missense possibly damaging 0.56
R1598:Cdc25a UTSW 9 109879893 frame shift probably null
R4135:Cdc25a UTSW 9 109881517 missense possibly damaging 0.62
R4301:Cdc25a UTSW 9 109889742 missense probably benign 0.23
R4386:Cdc25a UTSW 9 109889733 missense probably damaging 1.00
R5074:Cdc25a UTSW 9 109884140 missense possibly damaging 0.46
R5171:Cdc25a UTSW 9 109877161 missense probably benign 0.25
R5896:Cdc25a UTSW 9 109884365 missense probably benign 0.00
R5928:Cdc25a UTSW 9 109889793 missense probably damaging 1.00
R6240:Cdc25a UTSW 9 109884158 missense probably damaging 1.00
R6440:Cdc25a UTSW 9 109881498 missense probably benign
R6854:Cdc25a UTSW 9 109879927 missense probably damaging 1.00
R7219:Cdc25a UTSW 9 109889086 missense probably damaging 0.99
R7980:Cdc25a UTSW 9 109879881 missense probably damaging 1.00
R8506:Cdc25a UTSW 9 109891752 missense probably damaging 0.99
R8790:Cdc25a UTSW 9 109887348 critical splice donor site probably null
R8807:Cdc25a UTSW 9 109879235 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCCTACAGAGAAAGCCTC -3'
(R):5'- GTTTCCACAAAAGCCATGTATACAC -3'

Sequencing Primer
(F):5'- CTCACTGACATAACAGGCAGGTG -3'
(R):5'- TGTGTAGACTGGAGCAGCACTG -3'
Posted On2018-02-28