Incidental Mutation 'R6223:Zfp651'
ID504150
Institutional Source Beutler Lab
Gene Symbol Zfp651
Ensembl Gene ENSMUSG00000013419
Gene Namezinc finger protein 651
Synonyms4732420M22Rik
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6223 (G1)
Quality Score220.009
Status Not validated
Chromosome9
Chromosomal Location121759330-121771742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121763787 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 391 (R391Q)
Ref Sequence ENSEMBL: ENSMUSP00000091286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093772
AA Change: R391Q

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091286
Gene: ENSMUSG00000013419
AA Change: R391Q

DomainStartEndE-ValueType
BTB 45 141 3.69e-19 SMART
low complexity region 159 164 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 217 231 N/A INTRINSIC
low complexity region 302 339 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
ZnF_C2H2 447 470 1.28e-3 SMART
ZnF_C2H2 474 494 8.4e1 SMART
ZnF_C2H2 501 524 1.76e-1 SMART
ZnF_C2H2 531 553 3.34e-2 SMART
ZnF_C2H2 559 581 6.78e-3 SMART
ZnF_C2H2 587 609 3.63e-3 SMART
ZnF_C2H2 615 637 1.95e-3 SMART
ZnF_C2H2 643 665 6.62e-6 SMART
ZnF_C2H2 671 698 4.16e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213743
Predicted Effect unknown
Transcript: ENSMUST00000214732
AA Change: R426Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216791
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Other mutations in Zfp651
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Zfp651 APN 9 121763969 missense probably damaging 1.00
R0193:Zfp651 UTSW 9 121767666 missense probably damaging 0.98
R0270:Zfp651 UTSW 9 121767575 missense probably benign 0.27
R0347:Zfp651 UTSW 9 121763102 missense probably damaging 1.00
R0654:Zfp651 UTSW 9 121763261 missense probably benign 0.01
R2202:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2203:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2204:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2205:Zfp651 UTSW 9 121762637 missense possibly damaging 0.53
R2364:Zfp651 UTSW 9 121767594 missense probably damaging 0.98
R3843:Zfp651 UTSW 9 121763433 missense possibly damaging 0.86
R4275:Zfp651 UTSW 9 121766539 missense probably damaging 1.00
R4934:Zfp651 UTSW 9 121763979 missense probably damaging 0.99
R5358:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R5462:Zfp651 UTSW 9 121767663 missense probably damaging 0.99
R5613:Zfp651 UTSW 9 121767519 missense probably damaging 1.00
R5843:Zfp651 UTSW 9 121767339 missense possibly damaging 0.47
R5863:Zfp651 UTSW 9 121767530 missense probably benign 0.22
R6009:Zfp651 UTSW 9 121762871 missense possibly damaging 0.86
R6063:Zfp651 UTSW 9 121763532 missense probably benign 0.01
R6114:Zfp651 UTSW 9 121765595 missense probably damaging 1.00
R6414:Zfp651 UTSW 9 121763659 missense probably benign
R6811:Zfp651 UTSW 9 121766529 missense probably damaging 1.00
R7394:Zfp651 UTSW 9 121767345 missense probably damaging 0.98
R7430:Zfp651 UTSW 9 121763666 missense probably benign 0.02
R8215:Zfp651 UTSW 9 121767278 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGGAGCAGTCACAAATCATTG -3'
(R):5'- GGTACCAGCGGTTGTTGAAG -3'

Sequencing Primer
(F):5'- AATCCAGCCACTGTGGTG -3'
(R):5'- TTGAAGACCCGAGGGCACTTC -3'
Posted On2018-02-28