Incidental Mutation 'R6223:Myh3'
ID504155
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.654) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67098017 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1499 (V1499L)
Ref Sequence ENSEMBL: ENSMUSP00000131883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect probably benign
Transcript: ENSMUST00000007301
AA Change: V1499L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: V1499L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108689
AA Change: V1499L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: V1499L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165221
AA Change: V1499L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: V1499L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184592
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
bud UTSW 11 67096007 critical splice acceptor site probably null
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8169:Myh3 UTSW 11 67089030 missense probably benign 0.06
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8255:Myh3 UTSW 11 67095022 missense probably damaging 1.00
R8310:Myh3 UTSW 11 67096007 critical splice acceptor site probably null
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTCTGAGAGTAGCCACTTCAG -3'
(R):5'- CAACAGTGAACAGTTTCTATTGGTGC -3'

Sequencing Primer
(F):5'- TAGCCACTTCAGGGGTGACATTC -3'
(R):5'- GAACAGTTTCTATTGGTGCATCAGC -3'
Posted On2018-02-28