Incidental Mutation 'R6223:Vdac2'
ID504161
Institutional Source Beutler Lab
Gene Symbol Vdac2
Ensembl Gene ENSMUSG00000021771
Gene Namevoltage-dependent anion channel 2
SynonymsVdac6
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.383) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location21825238-21845879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21845178 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 265 (G265R)
Ref Sequence ENSEMBL: ENSMUSP00000134023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022293] [ENSMUST00000124549] [ENSMUST00000153320] [ENSMUST00000172727] [ENSMUST00000173456] [ENSMUST00000177527] [ENSMUST00000224373]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022293
AA Change: G277R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022293
Gene: ENSMUSG00000021771
AA Change: G277R

DomainStartEndE-ValueType
Pfam:Porin_3 15 288 4.5e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000022295
Predicted Effect probably benign
Transcript: ENSMUST00000124549
SMART Domains Protein: ENSMUSP00000119330
Gene: ENSMUSG00000021773

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Methyltransf_3 59 262 2.7e-58 PFAM
Pfam:Methyltransf_18 102 213 5.5e-9 PFAM
Pfam:Methyltransf_24 107 210 3.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152905
Predicted Effect probably benign
Transcript: ENSMUST00000153320
SMART Domains Protein: ENSMUSP00000115560
Gene: ENSMUSG00000021771

DomainStartEndE-ValueType
Pfam:Porin_3 15 201 1.6e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170150
Predicted Effect possibly damaging
Transcript: ENSMUST00000172727
AA Change: G265R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133525
Gene: ENSMUSG00000021771
AA Change: G265R

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 6.4e-80 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173456
AA Change: G265R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134023
Gene: ENSMUSG00000021771
AA Change: G265R

DomainStartEndE-ValueType
Pfam:Porin_3 3 276 6.4e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177527
SMART Domains Protein: ENSMUSP00000134830
Gene: ENSMUSG00000021773

DomainStartEndE-ValueType
Pfam:Methyltransf_3 1 200 1.6e-64 PFAM
Pfam:Methyltransf_18 40 150 4.2e-10 PFAM
Pfam:Methyltransf_24 45 148 1.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224373
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-dependent anion channel pore-forming family of proteins that are considered the main pathway for metabolite diffusion across the mitochondrial outer membrane. The encoded protein is also thought to be involved in the mitochondrial apoptotic pathway via regulation of BCL2-antagonist/killer 1 protein activity. Pseudogenes have been identified on chromosomes 1, 2, 12 and 21, and alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Olfr1509 A G 14: 52,450,679 R89G probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Vdac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Vdac2 APN 14 21838524 missense possibly damaging 0.53
IGL00536:Vdac2 APN 14 21838443 missense probably benign 0.06
IGL02828:Vdac2 APN 14 21843889 missense probably benign 0.11
R1171:Vdac2 UTSW 14 21837811 missense probably damaging 1.00
R1503:Vdac2 UTSW 14 21837877 missense probably damaging 0.96
R1952:Vdac2 UTSW 14 21837879 missense possibly damaging 0.71
R6221:Vdac2 UTSW 14 21845178 missense possibly damaging 0.94
R8491:Vdac2 UTSW 14 21837770 missense possibly damaging 0.54
Z1177:Vdac2 UTSW 14 21831901 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGCCCTCAGATGGTGTTGAC -3'
(R):5'- GAACCAGCCAACAGTGACTGTC -3'

Sequencing Primer
(F):5'- GGTGTTGACCATCAGTTTTTAGCACC -3'
(R):5'- GCTCTTGCTTCATCATCCTTTG -3'
Posted On2018-02-28