Incidental Mutation 'R6223:Olfr1509'
ID504162
Institutional Source Beutler Lab
Gene Symbol Olfr1509
Ensembl Gene ENSMUSG00000035626
Gene Nameolfactory receptor 1509
SynonymsMOR244-3, MOR83, GA_x6K02T2RJGY-534312-533386
MMRRC Submission 044354-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R6223 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52442990-52452574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52450679 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 89 (R89G)
Ref Sequence ENSEMBL: ENSMUSP00000146274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045066] [ENSMUST00000205900] [ENSMUST00000206100] [ENSMUST00000206437] [ENSMUST00000206718] [ENSMUST00000215030]
Predicted Effect probably benign
Transcript: ENSMUST00000045066
AA Change: R89G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046688
Gene: ENSMUSG00000035626
AA Change: R89G

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 301 3.3e-6 PFAM
Pfam:7tm_1 41 287 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205900
AA Change: R89G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206100
AA Change: R89G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206437
AA Change: R89G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206718
AA Change: R89G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215030
AA Change: R89G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A C 2: 152,427,953 R8S probably benign Het
Abca8b A G 11: 109,977,846 V164A probably benign Het
Acadm C A 3: 153,938,549 probably null Het
Ap3b2 G A 7: 81,473,462 R435* probably null Het
Art2b A G 7: 101,579,951 F247S possibly damaging Het
C1rb T A 6: 124,574,580 D216E probably benign Het
Casz1 C A 4: 148,933,383 D90E probably damaging Het
Ccdc13 A G 9: 121,798,909 probably benign Het
Cdc25a C A 9: 109,889,774 P409T possibly damaging Het
Cidea A C 18: 67,358,739 K23T possibly damaging Het
Clspn T A 4: 126,586,168 D1101E probably damaging Het
Col10a1 A T 10: 34,395,187 D385V probably damaging Het
Crat C T 2: 30,407,030 V304I probably benign Het
Cyp2d26 A T 15: 82,791,717 W265R probably benign Het
Dock8 A T 19: 25,161,052 Y1247F probably benign Het
Eed A G 7: 89,956,287 Y365H probably damaging Het
Fabp5 T A 3: 10,015,110 F73L probably benign Het
Fbn1 C T 2: 125,412,671 C224Y possibly damaging Het
Ggcx T C 6: 72,429,605 F684L probably damaging Het
Glrp1 G A 1: 88,503,442 Q69* probably null Het
Gm29797 T C 2: 181,659,057 V115A possibly damaging Het
Gtf3c1 C T 7: 125,676,625 R543K probably benign Het
Ifih1 T C 2: 62,598,259 I891V probably benign Het
Ifnar2 C T 16: 91,387,988 T89M probably damaging Het
Kat6a C A 8: 22,940,426 N1932K unknown Het
Mgat5 A T 1: 127,382,979 D210V possibly damaging Het
Mmel1 A G 4: 154,871,702 probably null Het
Myh3 G T 11: 67,098,017 V1499L probably benign Het
Ncan A C 8: 70,109,954 D551E probably benign Het
Nol11 G T 11: 107,171,616 T598K possibly damaging Het
Olfml3 G A 3: 103,736,460 R202W probably damaging Het
Olfr1362 G A 13: 21,611,366 T201I probably benign Het
Pcdh9 T C 14: 93,015,733 K1131E probably benign Het
Pcolce A G 5: 137,605,299 M424T probably damaging Het
Pi16 C A 17: 29,327,439 S397* probably null Het
Pi4ka A T 16: 17,357,571 Y464* probably null Het
Pik3c2b T A 1: 133,070,357 L324M probably damaging Het
Prdm2 T C 4: 143,142,207 N179S probably benign Het
Prss56 C T 1: 87,185,412 P183S probably benign Het
Prx T G 7: 27,516,836 M393R probably damaging Het
Qpctl T C 7: 19,143,209 D328G probably damaging Het
Qser1 A G 2: 104,787,648 S940P probably benign Het
Rchy1 G A 5: 91,957,967 R41W probably damaging Het
Scp2d1 T C 2: 144,823,948 I69T possibly damaging Het
Sirpb1a A G 3: 15,379,026 V388A probably benign Het
Ssu2 G T 6: 112,376,448 C238* probably null Het
Stub1 C T 17: 25,832,813 G14D probably damaging Het
Tab1 T A 15: 80,148,263 C24S probably damaging Het
Tdrd1 T C 19: 56,865,850 V1076A probably damaging Het
Tex10 T C 4: 48,468,525 R134G probably damaging Het
Tg T A 15: 66,707,922 N1525K probably benign Het
Tll2 G A 19: 41,135,952 T208I possibly damaging Het
Tmem232 T C 17: 65,500,196 M1V probably null Het
Ttc7b A G 12: 100,387,109 probably null Het
Ubb A G 11: 62,552,525 E127G possibly damaging Het
Ulk2 A T 11: 61,787,504 Y796* probably null Het
Vdac2 G A 14: 21,845,178 G265R possibly damaging Het
Vmn2r45 A T 7: 8,483,302 V329E probably benign Het
Wdr60 T C 12: 116,257,458 D11G possibly damaging Het
Zfp651 G A 9: 121,763,787 R391Q possibly damaging Het
Other mutations in Olfr1509
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1509 APN 14 52451027 missense probably benign 0.00
IGL01694:Olfr1509 APN 14 52450584 missense probably benign
IGL02656:Olfr1509 APN 14 52450709 missense possibly damaging 0.60
R0244:Olfr1509 UTSW 14 52450512 missense probably benign 0.00
R1249:Olfr1509 UTSW 14 52450522 missense probably benign
R1601:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
R1717:Olfr1509 UTSW 14 52450839 missense probably benign 0.00
R1953:Olfr1509 UTSW 14 52450887 missense probably benign 0.00
R4689:Olfr1509 UTSW 14 52451214 missense probably benign
R4943:Olfr1509 UTSW 14 52450594 nonsense probably null
R6516:Olfr1509 UTSW 14 52451129 missense probably damaging 1.00
R7323:Olfr1509 UTSW 14 52451213 missense probably benign 0.00
R7507:Olfr1509 UTSW 14 52450473 missense probably benign 0.00
R7674:Olfr1509 UTSW 14 52450442 missense probably benign 0.00
Z1088:Olfr1509 UTSW 14 52451209 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGAATTTATCTTCCTGGGCC -3'
(R):5'- GACAAGCTGTACACAGACCTTC -3'

Sequencing Primer
(F):5'- TGGGCCTCACTGACAACTG -3'
(R):5'- GACCTTCATGTTCATCACATTGGAG -3'
Posted On2018-02-28